SERBP1-SERPINE1 mRNA binding protein 1 Gene View larger

SERBP1-SERPINE1 mRNA binding protein 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERBP1-SERPINE1 mRNA binding protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SERBP1-SERPINE1 mRNA binding protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003049
Product type: DNA & cDNA
Ncbi symbol: SERBP1
Origin species: Human
Product name: SERBP1-SERPINE1 mRNA binding protein 1 Gene
Size: 2ug
Accessions: BC003049
Gene id: 26135
Gene description: SERPINE1 mRNA binding protein 1
Synonyms: CGI-55; CHD3IP; HABP4L; PAI-RBP1; PAIRBP1; plasminogen activator inhibitor 1 RNA-binding protein; PAI-1 mRNA binding protein; PAI1 RNA-binding protein 1; chromodomain helicase DNA binding protein 3 interacting protein; SERPINE1 mRNA binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgggcacttacaggaaggcttcggctgcgtggtcaccaaccgattcgaccagttatttgacgacgaatcggaccccttcgaggtgctgaaggcagcagagaacaagaaaaaagaagccggcgggggcggcgttgggggccctggggccaagagcgcagctcaggccgcggcccagaccaactccaacgcggcaggcaaacagctgcgcaaggagtcccagaaagaccgcaagaacccgctgccccccagcgttggcgtggttgacaagaaagaggagacgcagccgcccgtggcgcttaagaaagaaggaataagacgagttggaagaagacctgatcaacaacttcagggtgaagggaaaataattgatagaagaccagaaaggcgaccacctcgtgaacgaagattcgaaaagccacttgaagaaaagggtgaaggaggcgaattttcagttgatagaccgattattgaccgacctattcgaggtcgtggtggtcttggaagaggtcgagggggccgtggacgtggaatgggccgaggagatggatttgattctcgtggcaaacgtgaatttgataggcatagtggaagtgatagatcttctttttcacattacagtggcctgaagcacgaggacaaacgtggaggtagcggatctcacaactggggaactgtcaaagacgaattaacagagtcccccaaatacattcagaaacaaatatcttataattacagtgacttggatcaatcaaatgtgactgaggaaacacctgaaggtgaagaacatcatccagtggcagacactgaaaataaggagaatgaagttgaagaggtaaaagaggagggtccaaaagagatgactttggatgagtggaaggctattcaaaataaggaccgggcaaaagtagaatttaatatccgaaaaccaaatgaaggtgctgatgggcagtggaagaagggatttgttcttcataaatcaaagagtgaagaggctcatgctgaagattcggttatggaccatcatttccggaagccagcaaatgatataacgtctcagctggagatcaattttggagaccttggccgcccaggacgtggcggcaggggaggacgaggtggacgtgggcgtggtgggcgcccaaaccgtggcagcaggaccgacaagtcaagtgcttctgctcctgatgtggatgacccagaggcattcccagctctggcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein MGC24975
- EF-hand domain family, member A1
- EF-hand domain family, member A1
- cerebral cavernous malformation 2

Buy SERBP1-SERPINE1 mRNA binding protein 1 Gene now

Add to cart