RAD23A-RAD23 homolog A (S. cerevisiae) Gene View larger

RAD23A-RAD23 homolog A (S. cerevisiae) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAD23A-RAD23 homolog A (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAD23A-RAD23 homolog A (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014026
Product type: DNA & cDNA
Ncbi symbol: RAD23A
Origin species: Human
Product name: RAD23A-RAD23 homolog A (S. cerevisiae) Gene
Size: 2ug
Accessions: BC014026
Gene id: 5886
Gene description: RAD23 homolog A (S. cerevisiae)
Synonyms: HHR23A; HR23A; UV excision repair protein RAD23 homolog A; RAD23, yeast homolog, A; RAD23 homolog A, nucleotide excision repair protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgtcaccatcacgctcaaaacgctgcagcagcagaccttcaagatccgcatggagcctgacgagacggtgaaggtgctaaaggagaagatagaagctgagaagggtcgtgatgccttccccgtggctggacagaaactcatctatgccggcaagatcttgagtgacgatgtccctatcagggactatcgcatcgatgagaagaactttgtggtcgtcatggtgaccaagaccaaagccggccagggtacctcagcacccccagaggcctcacccacagctgccccagagtcctctacatccttcccgcctgcccccacctcaggcatgtcccatcccccacctgccgccagagaggacaagagcccatcagaggaatccgcccccacgacgtccccagagtctgtgtcaggctctgttccctcttcaggtagcagcgggcgagaggaagacgcggcctccacgctagtgacgggctctgagtatgagacgatgctgacggagatcatgtccatgggctatgagcgagagcgggtcgtggccgccctgagagccagctacaacaacccccaccgagccgtggagtatctgctcacgggaattcctgggagccccgagccggaacacggttctgtccaggagagccaggtatcggagcagccggccacggaagcagcaggagagaaccccctggagttcctgcgggaccagccccagttccagaacatgcggcaggtgattcagcagaaccctgcgctgctgcccgccctgctccagcagctgggccaggagaaccctcagcttttacagcaaatcagccggcaccaggagcagttcatccagatgctgaacgagccccctggggagctggcggacatctcagatgtggagggggaggtgggcgccataggagaggaggccccgcagatgaactacatccaggtgacgccgcaggagaaagaagctatagagaggttgaaggccctgggcttcccagagagcctggtcatccaggcctatttcgcgtgtgaaaaaaatgagaacttggctgccaacttcctcctgagtcagaactttgatgacgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lysophosphatidic acid receptor 1
- phosphoserine aminotransferase 1
- cell division cycle associated 7
- leucine rich repeat containing 2

Buy RAD23A-RAD23 homolog A (S. cerevisiae) Gene now

Add to cart