AGMAT-agmatine ureohydrolase (agmatinase) Gene View larger

AGMAT-agmatine ureohydrolase (agmatinase) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AGMAT-agmatine ureohydrolase (agmatinase) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AGMAT-agmatine ureohydrolase (agmatinase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005090
Product type: DNA & cDNA
Ncbi symbol: AGMAT
Origin species: Human
Product name: AGMAT-agmatine ureohydrolase (agmatinase) Gene
Size: 2ug
Accessions: BC005090
Gene id: 79814
Gene description: agmatine ureohydrolase (agmatinase)
Synonyms: agmatinase, mitochondrial; AUH; agmatine ureohydrolase (agmatinase)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgaggctgctggcgtccgggtgcgcccggggcccggggcccggcgtgggcgcgcgtcctgccgcagggctctttcatccggggcgccgccagagccgccaggcttccgatgcgccccggaaccagccccccagccccgagttcgtggcccggccggtgggcgtctgctccatgatgcgcctgccggtgcagacctcccccgaggggctggacgctgccttcatcggggtgcccctggatactgggacctccaaccggcctggggcgagattcggacctcgccgcatccgggaagaatcagtgatgcttcggacagtcaatcctagcacgggggccctccccttccagtccctcatggttgcagacctaggcgatgtgaatgtcaatctttacaaccttcaggacagctgccggcgaattcaagaggcctatgagaaaattgtagcagctggctgtattcctctgaccttgggtggagatcacacaatcacatatcccatattgcaagcgatggcaaaaaagcatggcccagtggggctgctgcacgtggatgcgcacacggacacgaccgacaaggccctaggagagaagctctaccacggggcgcccttccgccggtgtgtggatgagggtctcctggactgtaagcgtgtggtgcagattggcatccggggctcttccacgaccttggatccctacagatacaaccggagccagggcttccgggtagtcctggctgaagactgctggatgaagtcgctggttcctctgatgggggaagtcaggcagcagatgggaggcaaacccatttatatcagctttgatattgacgctctggatcctgcctatgcgccagggacagggacacctgaaattgctggtctcactcctagtcaggctctggagatcatcaggggttgtcaaggcctgaacgtgatgggctgtgatcttgtcgaagtttcaccaccgtatgatctttctgggaacacagccctgctggcggctaacctgctgtttgagatgctatgtgctctccccaaagtgacaaccgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - reticulon 4 interacting protein 1
- coiled-coil domain containing 123
- oxysterol binding protein-like 11
- adipocyte-specific adhesion molecule

Buy AGMAT-agmatine ureohydrolase (agmatinase) Gene now

Add to cart