CCDC123-coiled-coil domain containing 123 Gene View larger

CCDC123-coiled-coil domain containing 123 Gene

PTXBC032307

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC123-coiled-coil domain containing 123 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC123-coiled-coil domain containing 123 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032307
Product type: DNA & cDNA
Ncbi symbol: CCDC123
Origin species: Human
Product name: CCDC123-coiled-coil domain containing 123 Gene
Size: 2ug
Accessions: BC032307
Gene id: 84902
Gene description: coiled-coil domain containing 123
Synonyms: CCDC123; CEP123; centrosomal protein of 89 kDa; centrosomal protein 123; centrosomal protein 89kDa; coiled-coil domain containing 123; coiled-coil domain-containing protein 123, mitochondrial; centrosomal protein 89
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcctgggatttcggagaggccgcaggagtcatttcaaacacatcatccatggccttttacctgcagccagcgttgctccgaaggcagctgtgccacgcacacctcctccccgcagccccaacccatctccagagagaccaagatctgctctggcagcagccattctggcgacaacattgactgggcggacggttgctattcctcagcctcgccagaggtcccggtctgagagtgatgtgagcagtgttgaacaggacagcttcatcgagccctatgccaccacctcacagctgaggcctcggccaaattggcagagtgagatgggaagaagatcttctttgccatcctttgaaacactggactatggggacgaagaggacattgaaactcagctgtcatccagcggcaaggaattgggggatgtcagtgcccgggaggacagaggaggccacagtgatgacctgtacgctgtgccacacagaaatcaggtgccattgttacatgaggtgaacagtgaagacgatgaaaatatttctcatcaagatgggtttccaggctcccctcctgcaccacagcggacacaacaaaaagatggtaaacaccctgttctgaatttaaaggatgaaaaacctccattatgtgagaaacctccaccctccccagatataactggtagagcacgtcaaagatatacagaaataaccagagaaaagtttgaggcattaaaagaagaaaatatggacctaaacaatatgaatcaaagccttacccttgaactaaacacaatgaaacaagcaatgaaagaactacagttaaaacttaagggaatggaaaaagagaagagaaagctcaaagaggctgagaaggcgtcgtcacaggaagttgctgcacctgaattactttatctgcgaaaacaagctcaagaactggtggatgaaaatgatggattgaaaatgactgtccatcgtttgaatgtagaactcagtcgatatcagacaaaattcaggcatttgtccaaggaagaggtaacgtttccgattgtgaaaatcagcttttcagatttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - oxysterol binding protein-like 11
- adipocyte-specific adhesion molecule
- coiled-coil domain containing 74A
- gap junction protein, alpha 1, 43kDa

Buy CCDC123-coiled-coil domain containing 123 Gene now

Add to cart