OSBPL11-oxysterol binding protein-like 11 Gene View larger

OSBPL11-oxysterol binding protein-like 11 Gene

PTXBC010422

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OSBPL11-oxysterol binding protein-like 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about OSBPL11-oxysterol binding protein-like 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010422
Product type: DNA & cDNA
Ncbi symbol: OSBPL11
Origin species: Human
Product name: OSBPL11-oxysterol binding protein-like 11 Gene
Size: 2ug
Accessions: BC010422
Gene id: 114885
Gene description: oxysterol binding protein-like 11
Synonyms: ORP-11; ORP11; OSBP12; TCCCIA00292; oxysterol-binding protein-related protein 11; OSBP-related protein 11; testicular tissue protein Li 132; oxysterol binding protein like 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatttaacaagagtggtgcttcctacatttatcctagagaagcgttccttgctggaaatgtatgcagactttatgtctcatccagacctatttatagccatcactaatggagccacagctgaggacagaatgattcgctttgttgagtactaccttacctcatttcatgaaggccgtaagggagccattgctaaaaaaccatacaatcctatcattggagaaacatttcactgttcctggaagatgccaaaaagcgaggtagcatccagtgtttttagcagttcttccacccagggagtcacaaatcatgctcctttatcgggggagtctttgacccaggtgggatcagactgttacacagtcagatttgttgctgagcaggtttctcatcatcctccagtctcaggattttatgcagaatgtacagagaggaagatgtgtgtaaatgcgcatgtctggactaagagcaagttcttaggcatgtcaataggcgtgacaatggttggagaaggtatccttagtctgttggagcatggagaagagtacacattttctctaccctgtgcatatgctcggtcaattttgactgttccttgggtagaactgggtggcaaagtcagtgtcaactgtgcaaaaactggatattcagccagcatcacttttcataccaagccattttatggtggcaaactgcatcgggttacagctgaagtaaagcacaacatcaccaacactgtggtatgcagagtgcaaggggaatggaatagtgttcttgagttcacatatagcaatggagagacaaagtatgtggacttgactaaattggcagtgacgaagaaaagagtgagacctctggagaagcaggatccatttgaatccaggcgattgtggaaaaatgtgacagactcgctgagagaatctgaaattgataaggccacagagcataagcataccctggaagaacgtcagaggactgaagaaaggcatcgtactgaaacaggcacaccttggaaaaccaaatattttattaaagagggagatggctgggtttatcataaaccactttggaaaataattccaacaacacaaccagcagagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adipocyte-specific adhesion molecule
- coiled-coil domain containing 74A
- gap junction protein, alpha 1, 43kDa
- Fas apoptotic inhibitory molecule 3

Buy OSBPL11-oxysterol binding protein-like 11 Gene now

Add to cart