ASB1-ankyrin repeat and SOCS box-containing 1 Gene View larger

ASB1-ankyrin repeat and SOCS box-containing 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ASB1-ankyrin repeat and SOCS box-containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ASB1-ankyrin repeat and SOCS box-containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014528
Product type: DNA & cDNA
Ncbi symbol: ASB1
Origin species: Human
Product name: ASB1-ankyrin repeat and SOCS box-containing 1 Gene
Size: 2ug
Accessions: BC014528
Gene id: 51665
Gene description: ankyrin repeat and SOCS box-containing 1
Synonyms: ASB-1; ankyrin repeat and SOCS box protein 1; ankyrin repeat and SOCS box containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagggcggcagcccagacgggcgggcagggccgggctccgcaggtcgtaatctgaaggagtggctgagggagcaattttgtgatcatccgctggagcactgtgaggacacgaggctccatgatgcagcttacgtcggggacctccagaccctcaggagcctattgcaagaggagagctaccggagccgcatcaacgagaagtctgtctggtgctgtggctggctcccctgcacaccgttgcgaatcgcggccactgcaggccatgggagctgtgtggacttcctcatccggaagggggccgaggtggatctggtggacgtaaaaggacagacggccctgtatgtggctgtggtgaacgggcacctagagagtacccagatccttctcgaagctggcgcggaccccaacggaagccggcaccatcgcagcacccctgtctaccacgcctctcgcgtgggccgggcagacatcctgaaggccctcatcaggtacggggctgatgttgacgtcaaccaccacctgactcctgatgtccagcctcgattctcccggcggctcacctccttggtggtctgccccttgtacatcagcgcagcctaccacaacctccagtgcttccggctgctcctcctggctggcgcgaaccctgacttcaactgcaatggtcctgtcaacacacagggattctacaggggctcccctgggtgcgtcatggatgctgttctgcgccacggctgtgaggcagccttcgtgagcctgctggtagaatttggagccaacctgaatctagtgaagtgggaatcgctgggcccagagtcgagaggaagaagaaaagtggaccctgaggccttgcaggtctttaaagaggccagaagtgttcccagaaccttgctgtgtctgtgccgtgtggctgtgagaagagctcttggcaaacaccggcttcatctgattccttcgctgcctctgccagaccccataaagaagtttctactccatgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pregnancy specific beta-1-glycoprotein 5
- splicing factor, arginine/serine-rich 6
- glycoprotein 2 (zymogen granule membrane)
- methionine adenosyltransferase I, alpha

Buy ASB1-ankyrin repeat and SOCS box-containing 1 Gene now

Add to cart