MAT1A-methionine adenosyltransferase I, alpha Gene View larger

MAT1A-methionine adenosyltransferase I, alpha Gene

PTXBC018359

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAT1A-methionine adenosyltransferase I, alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAT1A-methionine adenosyltransferase I, alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018359
Product type: DNA & cDNA
Ncbi symbol: MAT1A
Origin species: Human
Product name: MAT1A-methionine adenosyltransferase I, alpha Gene
Size: 2ug
Accessions: BC018359
Gene id: 4143
Gene description: methionine adenosyltransferase I, alpha
Synonyms: MAT; MATA1; SAMS; SAMS1; S-adenosylmethionine synthase isoform type-1; MAT 1; MAT-I/III; S-adenosylmethionine synthetase isoform type-1; adoMet synthase 1; adoMet synthetase 1; methionine adenosyltransferase 1; methionine adenosyltransferase I, alpha; methionine adenosyltransferase I/III; methionine adenosyltransferase 1A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatggaccggtggatggcttgtgtgaccactctctaagtgaaggagtcttcatgttcacatcggagtctgtgggagagggacacccggataagatctgtgaccagatcagtgatgcagtgctggatgcccatctcaagcaagaccccaatgccaaggtggcctgtgagacagtgtgcaagaccggcatggtgctgctgtgtggtgagatcacctcaatggccatggtggactaccagcgggtggtgagggacaccatcaagcacatcggctacgatgactcagccaagggctttgacttcaagacttgcaacgtgctggtggctttggagcagcaatccccagatattgcccagtgcgtccatctggacagaaatgaggaggatgtgggggcaggagatcagggtttgatgttcggctatgccaccgacgagacagaggagtgcatgcccctcaccatcatccttgctcacaagctcaacgcccggatggcagacctcaggcgctccggcctcctcccctggctgcggcctgactctaagactcaggtgacagttcagtacatgcaggacaatggcgcagtcatccctgtgcgcatccacaccatcgtcatctctgtgcagcacaacgaagacatcacgctggaggagatgcgcagggccctgaaggagcaagtcatcagggccgtggtgccggccaagtacctggacgaagacaccgtctaccacctgcagcccagtgggcggtttgtcatcggaggtccccagggggatgcgggtgtcactggccgtaagattattgtggacacctatggcggctggggggctcatggtggtggggccttctctgggaaggactacaccaaggtggaccgctcagccgcttatgctgcccgctgggtggccaagtctctggtgaaagcagggctctgccggagagtgcttgtccaggtttcctatgccattggtgtggccgagccgctgtccatttccatcttcacctacggaacctctcagaagacagagcgagagctgctggatgtggtgcataagaacttcgacctccggccgggcgtcattgtcagggatttggacttgaagaagcccatctaccagaagacagcatgctacggccatttcggaagaagcgagttcccatgggaggttcccaggaagcttgtattttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pyruvate dehydrogenase kinase, isozyme 2
- lysosomal-associated membrane protein 2
- pregnancy specific beta-1-glycoprotein 4
- Rho guanine exchange factor (GEF) 16

Buy MAT1A-methionine adenosyltransferase I, alpha Gene now

Add to cart