PSG5-pregnancy specific beta-1-glycoprotein 5 Gene View larger

PSG5-pregnancy specific beta-1-glycoprotein 5 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSG5-pregnancy specific beta-1-glycoprotein 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSG5-pregnancy specific beta-1-glycoprotein 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012607
Product type: DNA & cDNA
Ncbi symbol: PSG5
Origin species: Human
Product name: PSG5-pregnancy specific beta-1-glycoprotein 5 Gene
Size: 2ug
Accessions: BC012607
Gene id: 5673
Gene description: pregnancy specific beta-1-glycoprotein 5
Synonyms: FL-NCA-3; PSG; pregnancy-specific beta-1-glycoprotein 5; PS-beta-G-5; PSBG-5; Pregnancy-specific beta-1-glycoprotein-5; fetal liver non-specific cross-reactive antigen 3; pregnancy-specific beta 1 glycoprotein; pregnancy-specific glycoprotein 5; pregnancy specific beta-1-glycoprotein 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcccctctcagcccctccctgcacacagcacatcacctggaagggggtcctgctcacagcatcacttttaaacttctggaacctgcctatcactgctcaagtcacgattgaagccctgccacccaaagtttccgaggggaaggatgttcttctacttgtccacaatttgcctcagaatcttgctggctacatctggtacaaaggacaactgatggacctctaccattacattacatcatatgtagtagacggtcaaataaatatatatgggcctgcatacactggacgagaaacagtatattccaatgcatccctgctgatccagaatgtcacccgggaagacgcaggatcctataccttacacatcataaagcgaggtgataggactagaggagtaactggatatttcaccttcaacttatacctgaagctgcccaagccctacatcaccatcaacaactcaaaacccagggagaataaggatgtcttagccttcacctgtgaacctaagagtgagaactacacctacatttggtggctaaatggtcagagcctcccggtcagtcccagggtaaagcaacccattgaaaacaggatcctcattctacccagtgtcacgagaaatgaaacaggaccctatgaatgtgaaatacgggaccgagatggtggcatgcacagtgacccagtcaccctgaatgtcctctatggtccagacctccccagcatttacccttcattcacctattaccgttcaggagaaaacctctacttgtcctgcttcgcggaatctaacccaccggcagagtatttttggacaattaatgggaagtttcagcaatcaggacaaaagctctctatcccccaaattactacaaagcatagagggctctatacttgctctgttcgtaactcagccactggcaaggaaagctccaaatccatgacagtcgaagtctctgctccttcaggaataggacgtcttcctctccttaatccaatatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - splicing factor, arginine/serine-rich 6
- glycoprotein 2 (zymogen granule membrane)
- methionine adenosyltransferase I, alpha
- pyruvate dehydrogenase kinase, isozyme 2

Buy PSG5-pregnancy specific beta-1-glycoprotein 5 Gene now

Add to cart