PTXBC008069
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008069 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | STAC3 |
| Origin species: | Human |
| Product name: | STAC3-SH3 and cysteine rich domain 3 Gene |
| Size: | 2ug |
| Accessions: | BC008069 |
| Gene id: | 246329 |
| Gene description: | SH3 and cysteine rich domain 3 |
| Synonyms: | NAM; SH3 and cysteine-rich domain-containing protein 3; SH3 and cysteine rich domain 3 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacttcccccagagccccaggccaatggggaggcagtgggagctgggggtgggcccatctactacatctatgaggaagaggaagaggaagaagaggaggaggaggagccacccccagaacctcctaagctggtcaacgataagccccacaaattcaaagatcacttcttcaagaagccaaagttctgtgatgtctgtgcccggatgattgttctcaacaacaagtttgggcttcgctgtaagaactgcaaaaccaacatccatgaacactgtcagtcctatgtggaaatgcagagatgcttcggcaagatcccacctggtttccatcgggcctatagttccccactctacagcaaccagcagtacgcttgtgtcaaagatctctctgctgccaatcgcaatgatcctgtgtttgaaaccctgcgcactggggtgatcatggcaaacaaggaacggaagaagggacaggcagataagaaaaatcctgtagcagccatgatggaggaggagccagagtcggccagaccagaggaaggcaaaccccaggatggaaaccctgaaggggataagaaggctgagaagaagacacctgatgacaagcacaagcagcctggcttccagcagtctcattactttgtggctctctatcggttcaaagccctggagaaggacgatctggatttcccgccaggagagaagatcacagtcattgatgactccaatgaagaatggtggcgggggaaaatcggggagaaggtcggatttttccctccaaacttcatcattcgggtccgggctggagaacgtgtgcaccgcgtgacgagatccttcgtggggaaccgcgagatagggcagatcactctcaagaaggaccagatcgtggtgcagaaaggagacgaagcgggcggctacgtcaaggtctacaccggccgcaaggtggggctgtttcccaccgactttctagaggaaatttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - RAD51-like 3 (S. cerevisiae) - GRB2-related adaptor protein 2 - neurogenic differentiation 6 - islet cell autoantigen 1, 69kDa |