Login to display prices
Login to display prices
STAC3-SH3 and cysteine rich domain 3 Gene View larger

STAC3-SH3 and cysteine rich domain 3 Gene

PTXBC008069

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STAC3-SH3 and cysteine rich domain 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STAC3-SH3 and cysteine rich domain 3 Gene

Proteogenix catalog: PTXBC008069
Ncbi symbol: STAC3
Product name: STAC3-SH3 and cysteine rich domain 3 Gene
Size: 2ug
Accessions: BC008069
Gene id: 246329
Gene description: SH3 and cysteine rich domain 3
Synonyms: NAM; SH3 and cysteine-rich domain-containing protein 3; SH3 and cysteine rich domain 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacttcccccagagccccaggccaatggggaggcagtgggagctgggggtgggcccatctactacatctatgaggaagaggaagaggaagaagaggaggaggaggagccacccccagaacctcctaagctggtcaacgataagccccacaaattcaaagatcacttcttcaagaagccaaagttctgtgatgtctgtgcccggatgattgttctcaacaacaagtttgggcttcgctgtaagaactgcaaaaccaacatccatgaacactgtcagtcctatgtggaaatgcagagatgcttcggcaagatcccacctggtttccatcgggcctatagttccccactctacagcaaccagcagtacgcttgtgtcaaagatctctctgctgccaatcgcaatgatcctgtgtttgaaaccctgcgcactggggtgatcatggcaaacaaggaacggaagaagggacaggcagataagaaaaatcctgtagcagccatgatggaggaggagccagagtcggccagaccagaggaaggcaaaccccaggatggaaaccctgaaggggataagaaggctgagaagaagacacctgatgacaagcacaagcagcctggcttccagcagtctcattactttgtggctctctatcggttcaaagccctggagaaggacgatctggatttcccgccaggagagaagatcacagtcattgatgactccaatgaagaatggtggcgggggaaaatcggggagaaggtcggatttttccctccaaacttcatcattcgggtccgggctggagaacgtgtgcaccgcgtgacgagatccttcgtggggaaccgcgagatagggcagatcactctcaagaaggaccagatcgtggtgcagaaaggagacgaagcgggcggctacgtcaaggtctacaccggccgcaaggtggggctgtttcccaccgactttctagaggaaatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: