RAD51L3-RAD51-like 3 (S. cerevisiae) Gene View larger

RAD51L3-RAD51-like 3 (S. cerevisiae) Gene

PTXBC014422

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAD51L3-RAD51-like 3 (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAD51L3-RAD51-like 3 (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014422
Product type: DNA & cDNA
Ncbi symbol: RAD51L3
Origin species: Human
Product name: RAD51L3-RAD51-like 3 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC014422
Gene id: 5892
Gene description: RAD51-like 3 (S. cerevisiae)
Synonyms: RAD51L3; BROVCA4; R51H3; TRAD; DNA repair protein RAD51 homolog 4; RAD51 homolog D; RAD51-like protein 3; recombination repair protein; RAD51 paralog D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgtgctcagggtcggactgtgccctggccttaccgaggagatgatccagcttctcaggagccacaggatcaagacagtggtggacctggtttctgcagacctggaagaggtagctcagaaatgtggcttgtcttacaaggccctggttgccctgaggcgggtgctgctggctcagttctcggctttccccgtgaatggcgctgatctctacgaggaactgaagacctccactgccatcctgtccactggcattggcagtcttgataaactgcttgatgctggtctctatactggagaagtgactgaaattgtaggaggcccaggtagcggcaaaactcaggtatgtctctgtatggcagcaaatgtggcccatggcctgcagcaaaacgtcctatatgtagattccaatggagggctgacagcttcccgcctcctccagctgcttcaggctaaaacccaggatgaggaggaacaggcagaagctctccggaggatccaggtggtgcatgcatttgacatcttccagatgctggatgtgctgcaggagctccgaggcactgtggcccagcaggtgactggttcttcaggaactgtgaaggtggtggttgtggactcggtcactgcggtggtttccccacttctgggaggtcagcagagggaaggcttggccttgatgatgcagctggcccgagagctgaagaccctggcccgggaccttggcatggcagtggtggtgaccaaccacataactcgagacagggacagcgggaggctcaaacctgccctcggacgctcctggagctttgtgcccagcactcggattctcctggacaccatcgagggagcaggagcatcaggcggccggcgcatggcgtgtctggccaaatcttcccgacagccaacaggtttccaggagatggtagacattgggacctgggggacctcagagcagagtgccacattacagggtgatcagacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GRB2-related adaptor protein 2
- neurogenic differentiation 6
- islet cell autoantigen 1, 69kDa
- filamin binding LIM protein 1

Buy RAD51L3-RAD51-like 3 (S. cerevisiae) Gene now

Add to cart