GRAP2-GRB2-related adaptor protein 2 Gene View larger

GRAP2-GRB2-related adaptor protein 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GRAP2-GRB2-related adaptor protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GRAP2-GRB2-related adaptor protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025692
Product type: DNA & cDNA
Ncbi symbol: GRAP2
Origin species: Human
Product name: GRAP2-GRB2-related adaptor protein 2 Gene
Size: 2ug
Accessions: BC025692
Gene id: 9402
Gene description: GRB2-related adaptor protein 2
Synonyms: GADS; GRAP-2; GRB2L; GRBLG; GRID; GRPL; GrbX; Grf40; Mona; P38; GRB2-related adapter protein 2; GRB-2-like protein; GRB2-related protein with insert domain; SH3-SH2-SH3 adapter Mona; SH3-SH2-SH3 adaptor molecule; adapter protein GRID; grf-40; grf40 adapter protein; growth factor receptor-binding protein; growth factor receptor-bound protein 2-related adaptor protein 2; hematopoietic cell-associated adapter protein GrpL; hematopoietic cell-associated adaptor protein GRPL; GRB2-related adaptor protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagctgttgccaagtttgatttcactgcttcaggtgaggatgaactgagctttcacactggagatgttttgaagattttaagtaaccaagaggagtggtttaaggcggagcttgggagccaggaaggatatgtgcccaagaatttcatagacatccagtttcccaaatggtttcacgaaggcctctctcgacaccaggcagagaacttactcatgggcaaggaggttggcttcttcatcatccgggccagccagagctccccaggggacttctccatctctgtcaggcatgaggatgacgttcaacacttcaaggtcatgcgagacaacaagggtaattactttctgtggactgagaagtttccatccctaaataagctggtagactactacaggacaaattccatctccagacagaagcagatcttccttagagacagaacccgagaagaccagggtcaccggggcaacagcctggaccggaggtcccagggaggcccacacctcagtggggctgtgggagaagaaatccgaccttcgatgaaccggaagctgtcggatcaccccccgacccttcccctgcagcagcaccagcaccagccacagcctccgcaatatgccccagcgccccagcagctgcagcagcccccacagcagcgatatctgcagcaccaccatttccaccaggaacgccgaggaggcagccttgacataaatgatgggcattgtggcaccggcttgggcagtgaaatgaatgcggccctcatgcatcggagacacacagacccagtgcagctccaggcggcagggcgagtgcggtgggcccgggcgctgtatgactttgaggccctggaggatgacgagctggggttccacagcggggaggtggtggaggtcctggatagctccaacccatcctggtggaccggccgcctgcacaacaagctgggcctcttccctgccaactacgtggcacccatgacccgataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neurogenic differentiation 6
- islet cell autoantigen 1, 69kDa
- filamin binding LIM protein 1
- dual specificity phosphatase 6

Buy GRAP2-GRB2-related adaptor protein 2 Gene now

Add to cart