PITX1-paired-like homeodomain 1 Gene View larger

PITX1-paired-like homeodomain 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PITX1-paired-like homeodomain 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PITX1-paired-like homeodomain 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009412
Product type: DNA & cDNA
Ncbi symbol: PITX1
Origin species: Human
Product name: PITX1-paired-like homeodomain 1 Gene
Size: 2ug
Accessions: BC009412
Gene id: 5307
Gene description: paired-like homeodomain 1
Synonyms: homeobox protein PITX1; BFT; CCF; LBNBG; POTX; PTX1; pituitary homeobox 1; hindlimb expressed homeobox protein backfoot; paired-like homeodomain transcription factor 1; pituitary homeo box 1; pituitary otx-related factor; paired like homeodomain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgccttcaaggggggcatgagcctggagcggctgccggaggggctccggccgccgccgccgccaccccatgacatggggcccgccttccacctggcccggcccgccgacccccgcgagccgctcgagaactccgccagcgagtcgtctgacacggagctgccagagaaggagcgcggcggggaacccaaggggcccgaggacagtggtgcgggaggcacgggctgcggcggcgcagacgacccagccaagaagaagaagcagcggcggcaacgtacgcacttcacaagccagcagttgcaagagctagaggccacgttccagaggaaccgctaccccgacatgagcatgagggaggagatcgccgtgtggaccaacctcaccgagccgcgcgtgcgggtctggttcaagaaccggcgagccaagtggcgtaagcgcgagcgtaaccagcagctggacctgtgcaagggtggctacgtgccgcagttcagcggcctagtgcagccctacgaggacgtgtacgccgccggctactcctacaacaactgggccgccaagagcctggcgccagcgccgctctccaccaagagcttcaccttcttcaactccatgagcccgctgtcgtcgcagtccatgttctcagcacccagctccatctcctccatgaccatgccgtccagcatgggcccaggcgccgtgcctggcatgcccaactcgggcctcaacaacatcaacaacctcaccggctcctcgctcaactcggccatgtcgccgggcgcttgcccgtacggcactcccgcctcgccctacagcgtctaccgggacacgtgcaactcgagcctagccagcctgcggctcaagtccaaacagcactcgtcgtttggctacggcggcctgcagggcccggcctcgggcctcaacgcgtgccagtacaacagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calpain, small subunit 1
- paired-like homeodomain 2
- LUC7-like (S. cerevisiae)
- G protein beta subunit-like

Buy PITX1-paired-like homeodomain 1 Gene now

Add to cart