FLJ11151-hypothetical protein FLJ11151 Gene View larger

FLJ11151-hypothetical protein FLJ11151 Gene

PTXBC006289

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FLJ11151-hypothetical protein FLJ11151 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FLJ11151-hypothetical protein FLJ11151 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006289
Product type: DNA & cDNA
Ncbi symbol: FLJ11151
Origin species: Human
Product name: FLJ11151-hypothetical protein FLJ11151 Gene
Size: 2ug
Accessions: BC006289
Gene id: 55313
Gene description: hypothetical protein FLJ11151
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggctgcagaggcggggggtgttttccacagagccaggggcaggaccctggacgcgtttcccgcagaaaaggaaagcgaatggaaaggcccattctacttcatcctgggcgcagacccacagtttgggctgatcaaggcctggtccactggggactgtgacaatggcggtgacgaatgggaacaggagatccgtctaactgagcaagccgtccaggccatcaacaagctgaaccccaaacccaaattcttcgttctgtgcggcgacctcatccacgccatgccagggaagccgtggcggacggagcagacggaggacctgaagcgagtgcttagggcagtggacagggccatcccactggtccttgtcagcggcaaccatgacattggcaacacccccacggccgagaccgtcgaggagttctgccggacttggggagatgactacttcagcttctgggtcgggggcgtcctgttcctggtcctcaactcccagttctacgagaacccctccaaatgccccagcctgaagcaggctcaggaccagtggctggacgagcagctgagcatcgcgaggcagcggcactgccagcatgccatcgtcttccagcacatcccgctgttcctggagagcatcgacgaggacgacgactactacttcaacctcagcaagtccactcggaagaagttggcagacaagttcatccacgcaggtgtcagagtcgtgttctcaggccactaccacaggaatgccgggggtacctaccagaacctcgacatggtggtgtcatctgccattggatgccagctgggcagagacccccacgggctccgagtcgtggtggtcaccgccgagaaaattgttcaccgatactacagtctagatgagctgagtgagaaaggaatagaagacgatctcatggatttgatcaagaaaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peroxisomal biogenesis factor 16
- casein kinase 1, alpha 1-like
- dual specificity phosphatase 12
- guanosine monophosphate reductase

Buy FLJ11151-hypothetical protein FLJ11151 Gene now

Add to cart