CSNK1A1L-casein kinase 1, alpha 1-like Gene View larger

CSNK1A1L-casein kinase 1, alpha 1-like Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CSNK1A1L-casein kinase 1, alpha 1-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CSNK1A1L-casein kinase 1, alpha 1-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028723
Product type: DNA & cDNA
Ncbi symbol: CSNK1A1L
Origin species: Human
Product name: CSNK1A1L-casein kinase 1, alpha 1-like Gene
Size: 2ug
Accessions: BC028723
Gene id: 122011
Gene description: casein kinase 1, alpha 1-like
Synonyms: CK1; casein kinase I isoform alpha-like; CKI-alpha-like; casein kinase I alpha S-like; casein kinase 1 alpha 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaaacaacagcggctccaaagccgaactcgttgtgggagggaaatacaaactggtgcggaagatcgggtctggctcctttggagacgtttatctgggcatcaccaccaccaacggcgaggaagtagcagtgaagctggaatctcagaaggtcaagcacccccagttgctgtatgagagcaaactctacacgattcttcaaggtggggttggcatcccccacatgcactggtatggtcaggaaaaagacaacaatgtgctagtcatggaccttctgggacccagcctcgaagacctctttaatttctgttcaagaaggttcaccatgaaaactgtacttatgttagccgaccagatgatcagcagaattgaatacgtgcatacaaagaattttctacaccgagacattaaaccagataacttcctgatgggtactgggcgtcactgtaataagttgttccttattgattttggtttggccaaaaagtacagagacaacaggaccaggcaacacataccgtacagagaagataaacacctcattggcactgtccgatatgccagcatcaatgcacatcttggtattgagcagagccgccgagatgacatggaatccttaggctacgttttcatgtattttaatagaaccagcctgccgtggcaaggactaaaggctatgacaaaaaaacaaaaatatgaaaagattagtgagaagaagatgtccacccctgttgaagttttatgtaaggggtttcctgcagaattcgccatgtacttgaactactgtcgtgggctgcgctttgaggaagtcccagattacatgtatctgaggcagctattccgcattcttttcaggaccctgaaccaccaatatgactacacatttgattggacgatgttaaagcagaaagcagcacagcaggcagcctcttccagtgggcagggtcagcaggcccaaacccagacaggcaagcaaactgaaaaaaacaagaataatgtgaaagataactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dual specificity phosphatase 12
- guanosine monophosphate reductase
- lysophosphatidic acid receptor 2
- PDZ and LIM domain 2 (mystique)

Buy CSNK1A1L-casein kinase 1, alpha 1-like Gene now

Add to cart