PEX16-peroxisomal biogenesis factor 16 Gene View larger

PEX16-peroxisomal biogenesis factor 16 Gene

PTXBC004356

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PEX16-peroxisomal biogenesis factor 16 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PEX16-peroxisomal biogenesis factor 16 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004356
Product type: DNA & cDNA
Ncbi symbol: PEX16
Origin species: Human
Product name: PEX16-peroxisomal biogenesis factor 16 Gene
Size: 2ug
Accessions: BC004356
Gene id: 9409
Gene description: peroxisomal biogenesis factor 16
Synonyms: peroxisomal membrane protein PEX16; PBD8A; PBD8B; peroxisomal biogenesis factor 16; peroxin 16; peroxisome biogenesis factor 16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaagctgcggctcctgggcctccgctaccaggagtacgtgactcgtcacccggccgccacggcccagctggagacagcagtgcggggcttcagttacctgctggcaggtcgattcgccgattcgcacgagctgtcagagctggtgtactctgcctctaacctgcttgtgctgctcaatgacgggatcctacggaaggagcttcggaaaaagttgcctgtgtcgctgtcccagcagaagctgctgacatggctgagcgtgctggagtgcgtggaggtgttcatggagatgggagctgccaaggtgtggggtgaagtgggccgctggcttgtcatcgccctcatccagctggccaaggctgtactgcggatgctcctgctgctctggttcaaggctggcctccagacttcaccccctatcgttccactggacagagagacccaggcacagcccccggatggtgaccacagccctggcaaccatgagcagtcctacgtggggaagcggtcaaaccgggtggtgcgaaccctccagaacacgccgtccctgcactccaggcactggggagctccccagcagcgggagggacggcagcagcagcatcacgaggagctgagtgcgacccccacccccctggggctgcaggagaccatcgcagagtttttgtacattgcccggccgctgctgcacttgctcagcctgggcctgtggggtcagaggtcgtggaaaccctggctcttggctggtgttgtggacgtgaccagcctgagcctcctgagtgacagaaagggcctgacccggagggagcggcgggagctgcggcgccggaccatcctgctgctctactacctgctgcgctctcctttctacgaccgcttctccgaggccaggatcctcttcctgctccagttgctggccgaccacgtccctggcgttggcctggtcacaaggccgctcatggattacttgcccacctggcagaaaatctacttctacagttggggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - casein kinase 1, alpha 1-like
- dual specificity phosphatase 12
- guanosine monophosphate reductase
- lysophosphatidic acid receptor 2

Buy PEX16-peroxisomal biogenesis factor 16 Gene now

Add to cart