RRAGA-Ras-related GTP binding A Gene View larger

RRAGA-Ras-related GTP binding A Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RRAGA-Ras-related GTP binding A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RRAGA-Ras-related GTP binding A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006433
Product type: DNA & cDNA
Ncbi symbol: RRAGA
Origin species: Human
Product name: RRAGA-Ras-related GTP binding A Gene
Size: 2ug
Accessions: BC006433
Gene id: 10670
Gene description: Ras-related GTP binding A
Synonyms: FIP-1; FIP1; RAGA; ras-related GTP-binding protein A; adenovirus E3 14.7 kDa-interacting protein 1; adenovirus E3-14.7K interacting protein 1; rag A; Ras related GTP binding A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaaatacagccatgaagaaaaaggtgctgctgatggggaagagcgggtcggggaagaccagcatgaggtcgataatcttcgccaattacattgctcgcgacacccggcgcctgggggccaccattgacgtggaacactcccacgtccgattcctagggaacctggtgctgaacctgtgggactgtggcggtcaggacaccttcatggaaaattacttcaccagccagcgagacaatatcttccgtaacgtggaagttttgatttacgtgtttgacgtggagagccgcgaactggaaaaggacatgcattattaccagtcgtgtctggaggccatcctccagaactctcctgacgccaaaatcttctgcctggtgcacaaaatggatctggttcaggaggatcagcgtgacctgatttttaaagagcgagaggaagacctgaggcgtctgtctcgcccgctggagtgtgcttgttttcgaacgtccatctgggatgagacgctctacaaagcctggtccagcatcgtctaccagctgattcccaacgttcagcagctggagatgaacctcaggaattttgcccaaatcattgaggccgatgaagttctgctgttcgaaagagctacattcttggttatttcccactaccagtgcaaagagcagcgcgacgtccaccggtttgagaagatcagcaacatcatcaaacagttcaagctgagctgcagtaaattggccgcttccttccagagcatggaagttaggaattccaacttcgctgctttcatcgacatcttcacctcaaatacgtacgtgatggtggtcatgtcagatccgtcgatcccttctgcggccactctgatcaacattcgcaatgcccggaaacactttgagaagctggagagagtggatggccccaagcacagtctccttatgcgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - paired-like homeodomain 1
- calpain, small subunit 1
- paired-like homeodomain 2
- LUC7-like (S. cerevisiae)

Buy RRAGA-Ras-related GTP binding A Gene now

Add to cart