LRRC59-leucine rich repeat containing 59 Gene View larger

LRRC59-leucine rich repeat containing 59 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRRC59-leucine rich repeat containing 59 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LRRC59-leucine rich repeat containing 59 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017168
Product type: DNA & cDNA
Ncbi symbol: LRRC59
Origin species: Human
Product name: LRRC59-leucine rich repeat containing 59 Gene
Size: 2ug
Accessions: BC017168
Gene id: 55379
Gene description: leucine rich repeat containing 59
Synonyms: PRO1855; p34; leucine-rich repeat-containing protein 59; ribosome-binding protein p34; leucine rich repeat containing 59
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccaaggccggtagcaagggcgggaacctccgcgacaagctggacggcaacgaactggacctgagcctcagcgacctgaatgaggtcccggtgaaggagctggctgcccttccaaaggccaccatcctggatctgtcttgtaataaactgactactctaccgtcggatttctgtggcctcacacacctggtgaagctagacctgagtaagaacaagctgcagcagctgccagcagactttggccgtctggtcaacctccagcacctggatctcctcaacaacaagctggtcaccttgcctgtcagctttgctcagctcaagaacctgaagtggttggacctgaaggataaccccctggatcctgtcctggccaaggtggcaggtgactgcttggatgagaagcagtgtaagcagtgtgcaaacaaggtgttacagcacatgaaggccgtgcaggcagatcaggagcgggagaggcagcggcggctggaagtagaacgtgaggcagagaagaagcgtgaggctaagcagcgagctaaggaagctcaggagcgggaactgcggaagcgggagaaggcggaagagaaggagcgccggagaaaggagtatgatgccctcaaagcagccaagcgggagcaggagaagaaacctaagaaggaagcaaatcaggccccgaaatctaagtctggctcccgtccccgcaagccaccaccccggaagcacactcgttcctgggctgtgctgaagctgctgctgctgctgctgctatttggtgtggcgggagggctggttgcttgtcgggtgacagagctgcagcagcagcccctctgcaccagcgtgaacaccatctatgacaatgcggtccagggtctacgccgccatgagatcctccagtgggtcctccagaccgactctcagcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetratricopeptide repeat domain 29
- leucine rich repeat containing 46
- thioredoxin domain containing 11
- chromosome 5 open reading frame 4

Buy LRRC59-leucine rich repeat containing 59 Gene now

Add to cart