C5orf4-chromosome 5 open reading frame 4 Gene View larger

C5orf4-chromosome 5 open reading frame 4 Gene

PTXBC007216

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C5orf4-chromosome 5 open reading frame 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C5orf4-chromosome 5 open reading frame 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007216
Product type: DNA & cDNA
Ncbi symbol: C5orf4
Origin species: Human
Product name: C5orf4-chromosome 5 open reading frame 4 Gene
Size: 2ug
Accessions: BC007216
Gene id: 10826
Gene description: chromosome 5 open reading frame 4
Synonyms: C5orf4; fatty acid hydroxylase domain-containing protein 2; fatty acid hydroxylase domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaggagaagctggacatatgctacacaatgaaaagtcaaagcaggagggacacatctggggctctatgaggaggacagctttcatcctgggctctggacttctctcatttgtggccttctggaactcagtgacatggcatcttcagagattttggggtgcttctggctacttttggcaagcccagtgggagaggctgctgactacatttgaagggaaggagtggatcctcttctttataggtgccatccaagtgccttgtctcttcttctggagcttcaatgggcttctattggtggttgacacaacaggaaaacctaacttcatctctcgctaccgaattcaggtcggcaagaatgaacctgtggatcctgtgaaactgcgccagtctatccgcacagttcttttcaaccagtgcatgatatctttccccatggtggtcttcctctatcccttcctcaaatggtggagagacccctgccgccgtgagctacccaccttccactggttcctcctggagctggccatcttcacgctgatcgaggaagtcttgttctactattcacaccggctccttcaccacccaacattctacaagaaaatccacaagaaacaccatgagtggacagctcccattggcgtgatctctctctatgcccaccctatagagcatgcagtctccaacatgctaccggtgatagtgggcccattagtaatgggctcccacttgtcctccatcaccatgtggttttccttggccctcatcatcaccaccatctcccactgtggctaccaccttcccttcctgccttcgcctgaattccacgactaccaccatctcaagttcaaccagtgctatggggtgctgggtgtgctggaccacctccatgggactgacaccatgttcaagcagaccaaggcctacgagagacatgtcctcctgctgggcttcaccccgctctctgagagcatcccagactccccaaagaggatggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine (C-X-C motif) receptor 6
- elastin microfibril interfacer 1
- dickkopf homolog 3 (Xenopus laevis)
- chemokine (C-X-C motif) receptor 4

Buy C5orf4-chromosome 5 open reading frame 4 Gene now

Add to cart