TXNDC11-thioredoxin domain containing 11 Gene View larger

TXNDC11-thioredoxin domain containing 11 Gene

PTXBC013727

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TXNDC11-thioredoxin domain containing 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TXNDC11-thioredoxin domain containing 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013727
Product type: DNA & cDNA
Ncbi symbol: TXNDC11
Origin species: Human
Product name: TXNDC11-thioredoxin domain containing 11 Gene
Size: 2ug
Accessions: BC013727
Gene id: 51061
Gene description: thioredoxin domain containing 11
Synonyms: thioredoxin domain-containing protein 11; EF-hand binding protein 1; thioredoxin domain containing 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctcaccctagagtcttttattcaaaacttcagcgttctctatagtcccttgaaaaggcatctcattggaagtggctctgcccagttcccgtctcagcatttaatcactgaagtgacaactgataccttttgggaagtagtccttcaaaaacaggacgttctcctgctctattacgctccgtggtgcggcttctgtccatccctcaatcacatcttcatccagctagctcggaacctgcccatggacacattcactgtggcaaggattgacgtgtctcagaatgaccttccttgggaatttatggtcgatcgtcttcctactgtcttgttttttccctgcaacagaaaggacctaagtgtgaaataccccgaagacgtccccatcacccttccaaacctgttgaggttcattttgcatcactcagaccctgcttccagcccccagaatgtggctaactctcctaccaaggagtgtcttcagagcgaggcagtcttacagcgggggcacatctcccacttggagagagagatccagaaactgagagcagaaataagcagcctccagcgagcacaagtgcaggtggagtcccagctctccagtgcccgcagagatgagcaccggctgcggcagcagcagcgggccctggaagagcagcacagcctgctccacgcacacagtgagcagctgcaggccctctatgagcagaagacacgtgagctgcaggagctggcccgcaagctgcaggagctggccgatgcctcagaaaacctccttaccgagaacacgtggctcaagatcctggtggcgaccatggagaggaaactggagggcagggatggagctgaaagcctggcggcccagagagaggtccaccccaagcagcctgagccctcagccaccccccagctccctggcagctcccctccacctgccaatgtcagcgccacactggtgtctgaaaggaataaggagaacaggacagactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 5 open reading frame 4
- chemokine (C-X-C motif) receptor 6
- elastin microfibril interfacer 1
- dickkopf homolog 3 (Xenopus laevis)

Buy TXNDC11-thioredoxin domain containing 11 Gene now

Add to cart