TMEM74-transmembrane protein 74 Gene View larger

TMEM74-transmembrane protein 74 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM74-transmembrane protein 74 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM74-transmembrane protein 74 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030710
Product type: DNA & cDNA
Ncbi symbol: TMEM74
Origin species: Human
Product name: TMEM74-transmembrane protein 74 Gene
Size: 2ug
Accessions: BC030710
Gene id: 157753
Gene description: transmembrane protein 74
Synonyms: NET36; transmembrane protein 74
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctccactaccttgctaagaagagcaaccaggcagacctctgtgatgccagggactggagttcaagagggctgcctggtgaccaggcagatacagcagccacaagagctgctctctgctgtcagaaacagtgtgcatccaccccaagagcaaccgagatggaagggtctaaacttagttcttctccagcatccccctcctcctctctgcaaaacagtactcttcagccagatgcctttccaccaggacttctccactcagggaacaaccaaataacagcggaacggaaagtctgtaactgctgcagccaggaattagaaacttcttttacctatgtggacaaaaacatcaacttggagcagcggaaccggagctcgccatcagcaaaagggcataatcaccctggggagcttggctgggaaaatccaaatgagtggtcccaagaggctgccatatctttgatatctgaagaggaggatgatacaagttcagaagccacgtcttcagggaagtctatagactatggtttcatcagcgccatcttgttcttggtcactgggatcctgctcgtgatcatctcttacatcgtcccacgggaagtgactgtggaccccaacactgtggcagcccgggagatggagcgcctggagaaggagagtgcgaggctgggggctcacctggaccgctgtgtgattgcggggctctgcctcctcacgctggggggcgtcatcctgtcctgcttgttaatgatgtccatgtggaagggggagctctatcgtcgaaacagatttgcctcttccaaagagtctgcaaaactctatggttctttcaacttcaggatgaaaaccagcacgaatgaaaacactctggaactgtccttggtagaggaagatgcgcttgctgtacagagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-myc (and STAT) interactor
- Ras-related GTP binding A
- paired-like homeodomain 1
- calpain, small subunit 1

Buy TMEM74-transmembrane protein 74 Gene now

Add to cart