Login to display prices
Login to display prices
SUNC1-Sad1 and UNC84 domain containing 1 Gene View larger

SUNC1-Sad1 and UNC84 domain containing 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SUNC1-Sad1 and UNC84 domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SUNC1-Sad1 and UNC84 domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026189
Product type: DNA & cDNA
Ncbi symbol: SUNC1
Origin species: Human
Product name: SUNC1-Sad1 and UNC84 domain containing 1 Gene
Size: 2ug
Accessions: BC026189
Gene id: 256979
Gene description: Sad1 and UNC84 domain containing 1
Synonyms: SUNC1; SUN domain-containing protein 3; Sad1 and UNC84 domain containing 1; sad1/unc-84 domain-containing protein 1; Sad1 and UNC84 domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttacactgacttttcttcttgtaggactcctaaatcatcagtggcttaaagaaacagatgttcctcagaaatccagacaattatatgccataattgcagaatatggttcaaggctttataaatatcaggccagacttcgtatgcctaaagagcaactggaacttttaaagaaggaaagccagaatctggaaaacaattttcgtcaaattctatttttggtcgaacaaatagatgtcctgaaggcattgctaagagatatgaaggatggtatggacaataatcacaactggaacacccatggagaccctgtggaggacccggaccacacagaggaagtgtcaaacttggtcaattatgtacttaaaaagttgagagaagaccaagtcgagatggctgattatgccctgaagtcggccggagcctccatcattgaagctgggacctcagaaagttataaaaataataaagcaaaattgtactggcatgggataggtttcctaaatcatgaaatgcctccagatattattcttcagccggatgtctaccctggaaagtgctgggcttttccaggttcccagggtcataccctaatcaagcttgctacaaagatcataccaactgctgttaccatggagcacatctcagagaaggtgtctccgtcaggaaacatctccagtgcacccaaggaattttctgtctatggcatcacaaaaaaatgtgaaggagaagaaattttcctaggtcagtttatatataacaaaacaggaaccaccgttcaaacatttgaactccagcatgcagtttctgaatatttattatgtgtgaaacttaatatctttagcaactggggacacccgaagtatacttgtttatatcgattcagggtccatggcacaccaggcaagcacatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine rich repeat containing 59
- tetratricopeptide repeat domain 29
- leucine rich repeat containing 46
- thioredoxin domain containing 11