Login to display prices
Login to display prices
WT1-Wilms tumor 1 Gene View larger

WT1-Wilms tumor 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WT1-Wilms tumor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about WT1-Wilms tumor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032861
Product type: DNA & cDNA
Ncbi symbol: WT1
Origin species: Human
Product name: WT1-Wilms tumor 1 Gene
Size: 2ug
Accessions: BC032861
Gene id: 7490
Gene description: Wilms tumor 1
Synonyms: EWS-WT1; AWT1; GUD; NPHS4; WAGR; WIT-2; WT33; Wilms tumor protein; Wilms tumor protein isoform Ex4a(+); Wilms tumor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaagggttacagcacggtcaccttcgacgggacgcccagctacggtcacacgccctcgcaccatgcggcgcagttccccaaccactcattcaagcatgaggatcccatgggccagcagggctcgctgggtgagcagcagtactcggtgccgcccccggtctatggctgccacacccccaccgacagctgcaccggcagccaggctttgctgctgaggacgccctacagcagtgacaatttataccaaatgacatcccagcttgaatgcatgacctggaatcagatgaacttaggagccaccttaaagggagttgctgctgggagctccagctcagtgaaatggacagaagggcagagcaaccacagcacagggtacgagagcgataaccacacaacgcccatcctctgcggagcccaatacagaatgcacacgcacggtgtcttcagaggcattcaggatgtgcggcgtgtgcctggagtagccccgactcttgtacggtcggcatctgagaccagtgagaaacgccccttcatgtgtgcttacccaggctgcaataagagatattttaagctgtcccacttacagatgcacagcaggaagcacactggtgagaaaccataccagtgtgacttcaaggactgtgaacgaaggttttctcgttcagaccagctcaaaagacaccaaaggagacatacaggtgtgaaaccattccagtgtaaaacttgtcagcgaaagttctcccggtccgaccacctgaagacccacaccaggactcatacaggtgaaaagcccttcagctgtcggtggccaagttgtcagaaaaagtttgcccggtcagatgaattagtccgccatcacaacatgcatcagagaaacatgaccaaactccagctggcgctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KIAA1191
- polybromo 1
- KIAA0174
- fibromodulin