Login to display prices
Login to display prices
PBRM1-polybromo 1 Gene View larger

PBRM1-polybromo 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PBRM1-polybromo 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PBRM1-polybromo 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015323
Product type: DNA & cDNA
Ncbi symbol: PBRM1
Origin species: Human
Product name: PBRM1-polybromo 1 Gene
Size: 2ug
Accessions: BC015323
Gene id: 55193
Gene description: polybromo 1
Synonyms: BAF180; PB1; protein polybromo-1; BRG1-associated factor 180; polybromo-1D; polybromo 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagaagaagatagtgaggtcattgaacctccttctctacctcagcttcagacccccctggccagtgagctggacctcatgccctacacacccccacagtctaccccaaagtctgccaaaggcagtgcaaagaaggaaggctccaaacggaaaatcaacatgagtggctacatcctgttcagcagtgagatgagggctgtgattaaggcccaacacccagactactctttcggggagctcagccgcctggtggggacagaatggagaaatcttgagacagccaagaaagcagaatatgaaggcatgatgggtggctatccgccaggccttccacctttgcagggcccagttgatggccttgttagcatgggcagcatgcagccacttcaccctggggggcctccaccccaccatcttccgccaggtgtgcctggcctcccgggcatcccaccaccgggtgtgatgaaccaaggagtggcccctatggtagggactccagcaccaggtggaagtccatatggacaacaggtgggagttttggggcctccagggcagcaggcaccacctccatatcccggcccacatccagctggaccccctgtcatacagcagccaacaacacccatgtttgtagctcccccaccaaagacccagcggcttcttcactcagaggcctacctgaaatacattgaaggactcagtgcggagtccaacagcattagcaagtgggatcagacactggcagctcgaagacgcgacgtccatttgtcgaaagaacaggagagccgcctaccctctcactggctgaaaagcaaaggggcccacaccaccatggcagatgccctctggcgccttcgagatttgatgctccgggacaccctcaacattcgccaagcatacaacctagaaaatgtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KIAA0174
- fibromodulin
- flotillin 2
- KIAA1712