Login to display prices
Login to display prices
KIAA1191-KIAA1191 Gene View larger

KIAA1191-KIAA1191 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIAA1191-KIAA1191 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KIAA1191-KIAA1191 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010448
Product type: DNA & cDNA
Ncbi symbol: KIAA1191
Origin species: Human
Product name: KIAA1191-KIAA1191 Gene
Size: 2ug
Accessions: BC010448
Gene id: 57179
Gene description: KIAA1191
Synonyms: p33MONOX; p60MONOX; brain-derived rescue factor p60MONOX; flavin monooxygenase motif-containing protein of 33 kDa; flavine monooxygenase motif-containing protein of 33 kDa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttcaagacaaccagaagtgcctgctcttgaggctagtgcgcctctaggcaagatgtccctgcccatcgggatataccgccgggcagtcagctatgatgataccctcgaggaccctgcgcccatgactcctcctccatcggacatgggcagcgtcccttggaagccagtgattccagagcgcaagtatcagcacctcgccaaggtggaggaaggagaggccagtctaccctcccctgccatgaccctgtcatcagccattgacagtgtggacaaggtcccagtggtgaaggctaaagctacccatgtcatcatgaattctctgatcacaaaacagacccaggaaagcattcagcattttgagcgacaggcagggctgagagatgctggctacacaccccacaagggcctcaccaccgaggagaccaagtaccttcgagtggccgaagcactccacaaactaaagttacagagtggagaggtaacaaaagaagagaggcagcctgcatcagcccagtccaccccaagcaccactccgcactcttcacctaagcagaggcccaggggctggttcacttctggttcttccacagccttacctggcccaaatcctagcaccatggactctggaagtggggataaggacagaaacttgtcagataagtggagcctctttggaccgagatcccttcagaagtacgattctggaagttttgccacccaggcctaccgaggagcccagaagccctctccattggaactgatacgtgcccaggccaaccgaatggctgaagatccagcagccttgaagccccccaagatggacatcccagtgatggaaggaaagaaacagccaccacgggcccataacctcaaaccccgtgacctgaatgtgctcacacccactggcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - polybromo 1
- KIAA0174
- fibromodulin
- flotillin 2