ZNF641-zinc finger protein 641 Gene View larger

ZNF641-zinc finger protein 641 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF641-zinc finger protein 641 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF641-zinc finger protein 641 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018090
Product type: DNA & cDNA
Ncbi symbol: ZNF641
Origin species: Human
Product name: ZNF641-zinc finger protein 641 Gene
Size: 2ug
Accessions: BC018090
Gene id: 121274
Gene description: zinc finger protein 641
Synonyms: zinc finger protein 641
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagctgcacttcttgcggctggatcacagggcctggtaaccatcaaggatgtgtcactgtgcttctctcaggaggagtggcggagcctggacccctctcagacagacttttatggagaatatgtcatgcaggaaaactgtgggatagtagtctctctgagatttccaattcccaaactggacatgctttctcaactagaaggaggagaagaacaatgggtccctgacccccaggacttagaggagagggacattctgagggtcacatatacaggagatggaagtgaacatgagggggatacccctgaactagaagcagaacctcccagaatgttatccagcgtgtctgaagatactgttctctggaacccggagcatgatgagagctgggattccatgccctgcagctccagaggaatgctcctggggcccccttttcttcaggaagatagtttctcaaacctgctgtgtagcacagagatggattccctgttaagaccccacacatgcccccagtgtgggaaacagtttgtatggggttcccaccttgccaggcatcaacaaacacacactggggagagaccctacagctgcctcaagtgtgagaagacctttgggcgaagacatcacctcatcaggcaccagaaaacccacctacatgacaagaccagcaggtgctctgagtgtggtaagaatttccgatgcaactcccatctggccagccaccagagagtgcatgcagaaggcaaatcctgcaaaggccaagaggttggagagagccctggcacaaggaaacggcagcgtgccccaccagtgccaaagtgtcacgtgtgcactgaatgtgggaagagctttggccgaaggcaccaccttgtgagacactggctgacccacactggggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cyclin-dependent kinase 4
- zinc finger protein 625
- glycoprotein, synaptic 2
- THAP domain containing 7

Buy ZNF641-zinc finger protein 641 Gene now

Add to cart