GPSN2-glycoprotein, synaptic 2 Gene View larger

GPSN2-glycoprotein, synaptic 2 Gene

PTXBC002425

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPSN2-glycoprotein, synaptic 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPSN2-glycoprotein, synaptic 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002425
Product type: DNA & cDNA
Ncbi symbol: GPSN2
Origin species: Human
Product name: GPSN2-glycoprotein, synaptic 2 Gene
Size: 2ug
Accessions: BC002425
Gene id: 9524
Gene description: glycoprotein, synaptic 2
Synonyms: GPSN2; MRT14; SC2; TER; very-long-chain enoyl-CoA reductase; glycoprotein, synaptic 2; synaptic glycoprotein SC2; trans-2,3-enoyl-CoA reductase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcattacgaggtggagattctggacgcaaagacaagggagaagctgtgtttcttggacaaggtggagccccacgccaccattgcggagatcaagaacctcttcactaagacccatccgcagtggtaccccgcccgccagtccctccgcctggaccccaagggcaagtccctgaaggatgaggatgttctgcagaagctgcccgtgggcaccacggccacactgtacttccgggacctgggggcccagatcagctgggtgacggtcttcctaacagagtacgcggggccccttttcatctacctgctcttctacttccgagtgcccttcatctatggccacaaatatgactttacgtccagtcggcatacagtggtgcacctcgcctgcatctgtcactcattccactacatcaagcgcctgctggagacgctcttcgtgcaccgcttctcccatggcactatgcctttgcgcaacatcttcaagaactgcacctactactggggcttcgccgcgtggatggcctattacatcaatcaccctctctacactccccctacctacggagctcagcaggtgaaactggcgctcgccatctttgtgatctgccagctcggcaacttctccatccacatggccctgcgggacctgcggcccgctgggtccaagacgcggaagatcccataccccaccaagaaccccttcacgtggctcttcctgctggtgtcctgccccaactacacctacgaggtggggtcctggatcggtttcgccatcatgacgcagtgtctcccagtggccctgttctccctggtgggcttcacccagatgaccatctgggccaagggcaagcaccgcagctacctgaaggagttccgggactacccgcccctgcgcatgcccatcatccccttcctgctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - THAP domain containing 7
- zinc finger protein 101
- high-mobility group 20B
- high-mobility group 20B

Buy GPSN2-glycoprotein, synaptic 2 Gene now

Add to cart