THAP7-THAP domain containing 7 Gene View larger

THAP7-THAP domain containing 7 Gene

PTXBC004346

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of THAP7-THAP domain containing 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about THAP7-THAP domain containing 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004346
Product type: DNA & cDNA
Ncbi symbol: THAP7
Origin species: Human
Product name: THAP7-THAP domain containing 7 Gene
Size: 2ug
Accessions: BC004346
Gene id: 80764
Gene description: THAP domain containing 7
Synonyms: THAP domain-containing protein 7; THAP domain containing 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcgtcactgctccgccgccggctgctgcacacgggacacgcgcgagacgcgcaaccgcggcatctccttccacagacttcccaagaaggacaacccgaggcgaggcttgtggctggccaactgccagcggctggaccccagcggccagggcctgtgggacccggcatccgagtacatctacttctgctccaaacactttgaggaggactgctttgagctggtgggaatcagtggatatcacaggctaaaggagggggcagtccccaccatatttgagtctttctccaagttgcgccggacaaccaagaccaaaggacacagttacccacctggcccccctgaagtcagccggctcagacgatgcaggaagcgctgctccgagggccgagggcccacaactccattttctccacctccacctgctgatgtcacctgctttcctgtggaagaggcctcagcacctgccactttgccggcctccccagctgggaggctggagcctggccttagcagccccttttcagacctactgggccccttgggtgcccaggcagatgaagcaggctgcagcgcccagccttcaccagagcggcagccctcccctctcgaaccacggccagtctccccctcagcgtatatgctgcgcctgcccccacccgccggagcctacatccagaatgaacacagctaccaggtgggcagcgccttactctggaagcggcgagccgaggcagcccttgatgcccttgacaaggcccagcgccagctgcaggcctgcaagcggcgggagcagcggctgcggttgagactgaccaagctgcagcaggagcgggcacgggagaagcgggcacaggcagatgcccgccagactctgaaggagcatgtgcaggactttgccatgcagctgagcagcagcatggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 101
- high-mobility group 20B
- high-mobility group 20B
- zinc finger protein 177

Buy THAP7-THAP domain containing 7 Gene now

Add to cart