PAPOLA-poly(A) polymerase alpha Gene View larger

PAPOLA-poly(A) polymerase alpha Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PAPOLA-poly(A) polymerase alpha Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PAPOLA-poly(A) polymerase alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000927
Product type: DNA & cDNA
Ncbi symbol: PAPOLA
Origin species: Human
Product name: PAPOLA-poly(A) polymerase alpha Gene
Size: 2ug
Accessions: BC000927
Gene id: 10914
Gene description: poly(A) polymerase alpha
Synonyms: PAP; poly(A) polymerase alpha; PAP-alpha; polynucleotide adenylyltransferase alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgtttccagttacaacacagggatcacaacaaacacaaccgccacagaagcactatggcattacttctcctatcagcttagcagcccccaaggagactgactgcgtacttacacagaaactaattgagacattgaaaccctttggggtttttgaagaggaagaggaactgcagcgcaggattttaattttgggaaaactaaataacctggtaaaagagtggatacgagaaatcagtgaaagcaagaatcttccacaatctgtaattgaaaatgttggaggaaaaatttttacatttggatcttacagattaggagtgcatacaaaaggtgctgatattgatgcgttgtgtgttgcaccaagacatgttgatcgaagtgactttttcacctcattctatgataagttgaaattacaggaagaagtaaaagatttaagagctgttgaagaggcattcgtaccagttattaaactctgttttgatgggatagagattgatattttgtttgcaagattagcactgcagacaattcctgaagatttggatctacgagatgacagtctgctaaaaaatttagatataagatgtataagaagtcttaacggttgcagggtaaccgatgaaattttacatctagtaccaaacattgacaacttcaggttaactctgagagctatcaaactatgggccaaacgccacaacatctattccaatatattaggtttcctcggtggtgtttcctgggctatgctagtagcaagaacttgccagctttatccaaatgcaatagcatcaactcttgtacataaatttttcttggtattttctaaatggtatgtgtttagattatattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ret finger protein-like 3
- sushi domain containing 4
- RWD domain containing 2A
- OTU domain containing 6B

Buy PAPOLA-poly(A) polymerase alpha Gene now

Add to cart