Login to display prices
Login to display prices
OTUD6B-OTU domain containing 6B Gene View larger

OTUD6B-OTU domain containing 6B Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OTUD6B-OTU domain containing 6B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about OTUD6B-OTU domain containing 6B Gene

Proteogenix catalog: PTXBC029760
Ncbi symbol: OTUD6B
Product name: OTUD6B-OTU domain containing 6B Gene
Size: 2ug
Accessions: BC029760
Gene id: 51633
Gene description: OTU domain containing 6B
Synonyms: CGI-77; DUBA-5; DUBA5; OTU domain-containing protein 6B; OTU domain containing 6B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcggtattgaccgaagagcttgatgaggaagagcagctgctgagaaggcatcgcaaagagaagaaggagttgcaagccaaaattcagggcatgaagaatgctgttcccaagaatgacaagaagaggaggaagcagctcaccgaagatgtggccaagttggaaaaagaaatggaacagaaacatagagaggaactggagcaattgaagctgactactaaggagaataagatagattctgttgctgttaacatttcaaacttggtgcttgagaatcagccacctcggatatcaaaagcacaaaagagacgggaaaagaaagctgcattggaaaaggagcgagaagaacggatagctgaagctgaaattgaaaacttaacaggagccagacatatggaaagtgagaaacttgctcaaatattggcagctagacagttagaaattaaacagattccatctgatggccactgtatgtataaagccattgaagatcaactgaaagaaaaggattgtgctctgactgtggttgccttgagaagtcagaccgctgagtatatgcaaagccatgtggaagactttctgccatttttaacaaaccctaatacaggagatatgtatactccagaagaatttcagaagtactgtgaagatattgtaaacacagctgcatggggaggtcagcttgagctaagagctctgtctcacattttacaaacaccaatagagataatacaggcagattctcctcccattatagttggtgaagaatattcaaaaaaaccactaatacttgtatatatgagacatgcatatggcttaggagaacattataattcggttacacggttggtaaacatagttactgaaaattgcagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice