OTUD6B-OTU domain containing 6B Gene View larger

OTUD6B-OTU domain containing 6B Gene

PTXBC029760

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OTUD6B-OTU domain containing 6B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about OTUD6B-OTU domain containing 6B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029760
Product type: DNA & cDNA
Ncbi symbol: OTUD6B
Origin species: Human
Product name: OTUD6B-OTU domain containing 6B Gene
Size: 2ug
Accessions: BC029760
Gene id: 51633
Gene description: OTU domain containing 6B
Synonyms: CGI-77; DUBA-5; DUBA5; OTU domain-containing protein 6B; OTU domain containing 6B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcggtattgaccgaagagcttgatgaggaagagcagctgctgagaaggcatcgcaaagagaagaaggagttgcaagccaaaattcagggcatgaagaatgctgttcccaagaatgacaagaagaggaggaagcagctcaccgaagatgtggccaagttggaaaaagaaatggaacagaaacatagagaggaactggagcaattgaagctgactactaaggagaataagatagattctgttgctgttaacatttcaaacttggtgcttgagaatcagccacctcggatatcaaaagcacaaaagagacgggaaaagaaagctgcattggaaaaggagcgagaagaacggatagctgaagctgaaattgaaaacttaacaggagccagacatatggaaagtgagaaacttgctcaaatattggcagctagacagttagaaattaaacagattccatctgatggccactgtatgtataaagccattgaagatcaactgaaagaaaaggattgtgctctgactgtggttgccttgagaagtcagaccgctgagtatatgcaaagccatgtggaagactttctgccatttttaacaaaccctaatacaggagatatgtatactccagaagaatttcagaagtactgtgaagatattgtaaacacagctgcatggggaggtcagcttgagctaagagctctgtctcacattttacaaacaccaatagagataatacaggcagattctcctcccattatagttggtgaagaatattcaaaaaaaccactaatacttgtatatatgagacatgcatatggcttaggagaacattataattcggttacacggttggtaaacatagttactgaaaattgcagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SPRY domain containing 5
- transmembrane protein 59
- kelch-like 3 (Drosophila)
- transmembrane protein 74

Buy OTUD6B-OTU domain containing 6B Gene now

Add to cart