Cart 2 Product Products 235,04 € (empty)
-
1 x FSHB-folli...113,40 € -
No products
To be determined Shipping
235,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 235,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 235,04 €
Data sheet of RFPL3-ret finger protein-like 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RFPL3-ret finger protein-like 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031689 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RFPL3 |
| Origin species: | Human |
| Product name: | RFPL3-ret finger protein-like 3 Gene |
| Size: | 2ug |
| Accessions: | BC031689 |
| Gene id: | 10738 |
| Gene description: | ret finger protein-like 3 |
| Synonyms: | ret finger protein-like 3; ret finger protein like 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcactcttccaagaagcaagcagctgtcccgtctgctcagactatctggaaaaaccaatgtccctggagtgtggatgcaccgtctgcctcaagtgcatcaattcgctgcagaaggagccccatggggaggatctgctttgctgttgctgttccatggtctctcagaggaacaaaatcaggcccaatcggcagctagagaggctggtttcccacatcaaggaactggagcccaagatgaagaagattctacagatgaacccaaggatgcggaagttccaagtggatatgaccttggatgccgacacagccaacaacttcctcctcatttctgacgacctcaggagcgtccgaagtgggctcatcacacagaatcggcaagaccttgccgagagatttgacgtgtccgtttgcatcctgggctcccctcgctttacctgtggccgccactactgggaggtggacgtgggaacaagcacagaatgggacctgggagtctgcagagaatctgttcactgcaaagggaagatccagctgaccacagagcttggattctggactgtgagtttgagggatggaagccgcctctctgccagcacggtgccgctgactttcctcttagtagaccgcaagttacagcgagtggggatttttctggatatgggcatgcagaacgtttccttttttgatgctgaaagtggttcccatgtctatacattcaggagcgtctctgctgaggagccactgcgcccatttttggctccttcaattccacctaatggtgatcagggtgtcttgagcatctgtcctttgatgaactcaggcactactgatgctccagtccgtcctggggaggccaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sushi domain containing 4 - RWD domain containing 2A - OTU domain containing 6B - SPRY domain containing 5 |