Login to display prices
Login to display prices
PEX7-peroxisomal biogenesis factor 7 Gene View larger

PEX7-peroxisomal biogenesis factor 7 Gene

PTXBC031606

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PEX7-peroxisomal biogenesis factor 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PEX7-peroxisomal biogenesis factor 7 Gene

Proteogenix catalog: PTXBC031606
Ncbi symbol: PEX7
Product name: PEX7-peroxisomal biogenesis factor 7 Gene
Size: 2ug
Accessions: BC031606
Gene id: 5191
Gene description: peroxisomal biogenesis factor 7
Synonyms: PBD9B; PTS2R; RCDP1; peroxisomal biogenesis factor 7; PTS2 receptor; peroxin-7; peroxisomal PTS2 receptor; peroxisomal targeting signal 2 receptor; peroxisome targeting signal 2 receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgcggtgtgcggtggagcggcgcggatgctgcggacgccgggacgccacggctacgccgccgagttctccccgtacctgccgggccgcctggcctgcgccaccgcgcagcactacggcatcgcgggctgtggaaccctactaatattggatccagatgaagctgggctaaggctttttagaagctttgactggaatgatggtttgtttgatgtgacttggagtgagaacaacgaacatgtcctcatcacctgtagtggcgatggctcgctgcagctctgggacactgccaaagctgcagggccactgcaagtctataaagaacacgctcaggaggtgtatagtgttgattggagccaaaccagaggtgaacagcttgtggtgtctggctcatgggatcaaactgtcaaattgtgggatccaactgttggaaagtctctgtgcacctttagaggccatgaaagtattatttatagcacaatctggtctccccacatccctggttgttttgcttcagcctcaggtgatcagactctgagaatatgggatgtgaaggcagcaggagtaagaatcgtgattcctgcacatcaggcagaaatcttgagttgtgactggtgtaaatacaatgagaatttgctggtgaccggggcggttgactgtagtttgagaggctgggacttaaggaatgtacgacaaccagtgtttgaacttcttggtcatacctatgctattaggagggtgaaaatggagtcttgccctgtcacccagacacgatctcagctcactgcaacctctgccttctgggttcaagctgttctcctgcctcagcctactgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: