PEX7-peroxisomal biogenesis factor 7 Gene View larger

PEX7-peroxisomal biogenesis factor 7 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PEX7-peroxisomal biogenesis factor 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PEX7-peroxisomal biogenesis factor 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031606
Product type: DNA & cDNA
Ncbi symbol: PEX7
Origin species: Human
Product name: PEX7-peroxisomal biogenesis factor 7 Gene
Size: 2ug
Accessions: BC031606
Gene id: 5191
Gene description: peroxisomal biogenesis factor 7
Synonyms: PBD9B; PTS2R; RCDP1; peroxisomal biogenesis factor 7; PTS2 receptor; peroxin-7; peroxisomal PTS2 receptor; peroxisomal targeting signal 2 receptor; peroxisome targeting signal 2 receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgcggtgtgcggtggagcggcgcggatgctgcggacgccgggacgccacggctacgccgccgagttctccccgtacctgccgggccgcctggcctgcgccaccgcgcagcactacggcatcgcgggctgtggaaccctactaatattggatccagatgaagctgggctaaggctttttagaagctttgactggaatgatggtttgtttgatgtgacttggagtgagaacaacgaacatgtcctcatcacctgtagtggcgatggctcgctgcagctctgggacactgccaaagctgcagggccactgcaagtctataaagaacacgctcaggaggtgtatagtgttgattggagccaaaccagaggtgaacagcttgtggtgtctggctcatgggatcaaactgtcaaattgtgggatccaactgttggaaagtctctgtgcacctttagaggccatgaaagtattatttatagcacaatctggtctccccacatccctggttgttttgcttcagcctcaggtgatcagactctgagaatatgggatgtgaaggcagcaggagtaagaatcgtgattcctgcacatcaggcagaaatcttgagttgtgactggtgtaaatacaatgagaatttgctggtgaccggggcggttgactgtagtttgagaggctgggacttaaggaatgtacgacaaccagtgtttgaacttcttggtcatacctatgctattaggagggtgaaaatggagtcttgccctgtcacccagacacgatctcagctcactgcaacctctgccttctgggttcaagctgttctcctgcctcagcctactgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PHD finger protein 20-like 1
- glioblastoma amplified sequence
- sterol-C4-methyl oxidase-like
- tyrosyl-DNA phosphodiesterase 1

Buy PEX7-peroxisomal biogenesis factor 7 Gene now

Add to cart