GBAS-glioblastoma amplified sequence Gene View larger

GBAS-glioblastoma amplified sequence Gene

PTXBC000732

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GBAS-glioblastoma amplified sequence Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GBAS-glioblastoma amplified sequence Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000732
Product type: DNA & cDNA
Ncbi symbol: GBAS
Origin species: Human
Product name: GBAS-glioblastoma amplified sequence Gene
Size: 2ug
Accessions: BC000732
Gene id: 2631
Gene description: glioblastoma amplified sequence
Synonyms: NIPSNAP2; protein NipSnap homolog 2; 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like 2; glioblastoma amplified sequence
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgcgagtgctgcgcgcccgcggagcggcctgggccggcggcctcctgcagcgggcggccccctgcagcctcctgcccaggctccggacatggacatcttccagcaacagatctcgagaagacagctggctaaaatccttatttgtccggaaagttgatccaagaaaagatgcccactccaatctcctagccaaaaaggaaacaagcaatctatacaaattacagtttcacaatgttaaaccggaatgcctagaagcatacaacaaaatttgtcaagaggtgttgccaaagattcacgaagataaacactacccttgtactttggtggggacttggaacacgtggtatggcgagcaggaccaagctgtccacctctggaggtatgaaggaggctatccagccctcacagaagtcatgaataaactcagagaaaataaggaatttttggaatttcgtaaggcaagaagtgacatgcttctctccaggaagaatcagctcctgttggagttcagtttctggaatgagcctgtgccaagatccggacctaatatatatgaactcaggtcttaccaactccgaccaggaaccatgattgaatggggcaattactgggctcgtgcaatccgcttcagacaggatggtaacgaagccgtcggaggattcttctctcagattgggcagctgtacatggtgcaccatctttgggcttacagggatcttcagaccagggaagacatacggaatgcagcatggcacaaacatggctgggaggaattggtatattacacagttccacttattcaggaaatggaatccagaatcatgatcccactgaagacctcgcccctccagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sterol-C4-methyl oxidase-like
- tyrosyl-DNA phosphodiesterase 1
- glyoxalase domain containing 4
- aspartoacylase (aminocyclase) 3

Buy GBAS-glioblastoma amplified sequence Gene now

Add to cart