Login to display prices
Login to display prices
SC4MOL-sterol-C4-methyl oxidase-like Gene View larger

SC4MOL-sterol-C4-methyl oxidase-like Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SC4MOL-sterol-C4-methyl oxidase-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SC4MOL-sterol-C4-methyl oxidase-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010653
Product type: DNA & cDNA
Ncbi symbol: SC4MOL
Origin species: Human
Product name: SC4MOL-sterol-C4-methyl oxidase-like Gene
Size: 2ug
Accessions: BC010653
Gene id: 6307
Gene description: sterol-C4-methyl oxidase-like
Synonyms: SC4MOL; DESP4; MCCPD; methylsterol monooxygenase 1; C-4 methylsterol oxidase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaacaaatgaaagtgtcagcatctttagttcagcatccttggctgtggaatatgtagattcacttttacctgagaatcctctgcaagaaccatttaaaaatgcttggaactatatgttgaataattatacaaagttccagattgcaacatggggatcccttatagttcatgaagccctttatttcttattctgtttacctggatttttatttcaatttataccttatatgaaaaaatacaaaattcaaaaggataagccagagacatgggaaaaccaatggaagtgtttcaaagttcttctctttaatcacttctgtatccagctgcctttgatttgtggaacctattattttacagagtatttcaatattccttatgattgggaaagaatgccaagatggtattttcttttggcaagatgctttggttgtgcagtcattgaagatacttggcactattttctgcatagactcttacaccacaaaagaatatacaagtatattcataaagttcatcatgagtttcaggctccatttggaatggaagctgaatatgcacatcctttggagactctaattcttggaactggatttttcattggaatcgtgcttttgtgtgatcatgtaattcttctttgggcatgggtgaccattcgtttattagaaactattgatgtccatagtggttatgatattcctctcaaccctttaaatctgatccctttctatgctggttctcggcatcatgatttccaccacatgaacttcattggaaactatgcttcaacatttacatggtgggatcgaatttttggaacagactctcagtataatgcctataatgaaaagaggaagaagtttgagaaaaagactgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tyrosyl-DNA phosphodiesterase 1
- glyoxalase domain containing 4
- aspartoacylase (aminocyclase) 3
- per1-like domain containing 1