HAX1-HCLS1 associated protein X-1 Gene View larger

HAX1-HCLS1 associated protein X-1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HAX1-HCLS1 associated protein X-1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HAX1-HCLS1 associated protein X-1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014314
Product type: DNA & cDNA
Ncbi symbol: HAX1
Origin species: Human
Product name: HAX1-HCLS1 associated protein X-1 Gene
Size: 2ug
Accessions: BC014314
Gene id: 10456
Gene description: HCLS1 associated protein X-1
Synonyms: HCLSBP1; HS1BP1; SCN3; HCLS1-associated protein X-1; HAX-1; HCLS1 (and PKD2) associated protein; HS1 binding protein; HS1-associating protein X-1; HS1-binding protein 1; HSP1BP-1; HCLS1 associated protein X-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcctctttgatctcttccggggctttttcggctttcctggacctcggagccacagagatcccttttttggagggatgactcgagatgaagatgatgatgaggaagaagaagaagaagggggctcatggggccgtgggaacccaaggttccatagtcctcagcacccccctgaggaatttggcttcggcttcagcttcagcccaggaggagggatacgtttccacgataacttcggctttgatgacctagtacgagatttcaatagcatcttcagcgatatgggggcctggaccttgccttcccatcctcctgaacttccaggtcctgagtcagagacacctggtgagagactacgggagggacagacacttcgggactcaatgcttaagtatccagatagtcaccagcccaggatctttgggggggtcttggagagtgatgcaagaagtgaatccccccaaccagcaccagactggggctcccagaggccatttcataggtttgatgatgtatggcctatggacccccatcctagaaccagagaggacaatgatcttgattcccaggtttcccaggagggtcttggcccggttctacagccccagcccaaatcctatttcaagagcatctctgtgaccaagatcactaaaccagatgggatagtggaggagcgccggactgtggtggacagtgagggccggacagagactacagtaacccgacacgaagcagatagcagtcctaggggtgatccagaatcaccaagacctccagccctggatgatgccttttccatcctggacttattcctgggacgttggttccggtcccggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - troponin T type 2 (cardiac)
- transmembrane channel-like 4
- ketohexokinase (fructokinase)
- thyrotrophic embryonic factor

Buy HAX1-HCLS1 associated protein X-1 Gene now

Add to cart