TEF-thyrotrophic embryonic factor Gene View larger

TEF-thyrotrophic embryonic factor Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TEF-thyrotrophic embryonic factor Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TEF-thyrotrophic embryonic factor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039258
Product type: DNA & cDNA
Ncbi symbol: TEF
Origin species: Human
Product name: TEF-thyrotrophic embryonic factor Gene
Size: 2ug
Accessions: BC039258
Gene id: 7008
Gene description: thyrotrophic embryonic factor
Synonyms: TEF, PAR bZIP transcription factor; thyrotroph embryonic factor; thyrotrophic embryonic factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgacgcgggcggcggaaagaagccgcctgtggacccgcaggcaggacccggtccggggccggggcgcgcagctggggaaaggggcctgtcggggtccttccccctggtcctgaagaagctgatggagaaccccccgcgcgaggcgcgcctcgataaggaaaaggggaaggaaaagctggaggaggacgaggccgcagccgccagcaccatggctgtctcagcctccctcatgccacccatctgggacaagaccatcccatatgatggcgaatctttccacctggagtacatggacctggatgagttcctgctggagaatggcatccccgccagccccacccacctggcccacaacctgctgctgcctgtagcagagctagaagggaaggagtctgccagctcttccacagcatccccaccatcctcctccactgccatctttcagccctctgaaactgtgtccagcacagaatcttccctggagaaggagagggagactcccagtcccatcgaccccaattgtgtggaagtggatgtgaacttcaatccggaccccgccgacctggtgctctccagtgtgccaggcggggagctcttcaaccctcggaagcacaagtttgctgaggaggacctgaagccccagcctatgatcaaaaaggccaagaaggtctttgtccccgacgagcagaaggatgaaaagtactggacaagacgcaagaagaacaacgtggcagctaaacggtcacgggatgcccggcgcctgaaagagaatcagatcaccatccgggcagccttcctggagaaggagaacacagccctgcggacggaggtggccgagctacgcaaggaggtgggcaagtgcaagaccatcgtgtccaagtatgagaccaaatacgggcccttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - HORMA domain containing 2
- transmembrane protein 177
- GRAM domain containing 1C
- mortality factor 4 like 1

Buy TEF-thyrotrophic embryonic factor Gene now

Add to cart