Login to display prices
Login to display prices
TEF-thyrotrophic embryonic factor Gene View larger

TEF-thyrotrophic embryonic factor Gene

PTXBC039258

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TEF-thyrotrophic embryonic factor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TEF-thyrotrophic embryonic factor Gene

Proteogenix catalog: PTXBC039258
Ncbi symbol: TEF
Product name: TEF-thyrotrophic embryonic factor Gene
Size: 2ug
Accessions: BC039258
Gene id: 7008
Gene description: thyrotrophic embryonic factor
Synonyms: TEF, PAR bZIP transcription factor; thyrotroph embryonic factor; thyrotrophic embryonic factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgacgcgggcggcggaaagaagccgcctgtggacccgcaggcaggacccggtccggggccggggcgcgcagctggggaaaggggcctgtcggggtccttccccctggtcctgaagaagctgatggagaaccccccgcgcgaggcgcgcctcgataaggaaaaggggaaggaaaagctggaggaggacgaggccgcagccgccagcaccatggctgtctcagcctccctcatgccacccatctgggacaagaccatcccatatgatggcgaatctttccacctggagtacatggacctggatgagttcctgctggagaatggcatccccgccagccccacccacctggcccacaacctgctgctgcctgtagcagagctagaagggaaggagtctgccagctcttccacagcatccccaccatcctcctccactgccatctttcagccctctgaaactgtgtccagcacagaatcttccctggagaaggagagggagactcccagtcccatcgaccccaattgtgtggaagtggatgtgaacttcaatccggaccccgccgacctggtgctctccagtgtgccaggcggggagctcttcaaccctcggaagcacaagtttgctgaggaggacctgaagccccagcctatgatcaaaaaggccaagaaggtctttgtccccgacgagcagaaggatgaaaagtactggacaagacgcaagaagaacaacgtggcagctaaacggtcacgggatgcccggcgcctgaaagagaatcagatcaccatccgggcagccttcctggagaaggagaacacagccctgcggacggaggtggccgagctacgcaaggaggtgggcaagtgcaagaccatcgtgtccaagtatgagaccaaatacgggcccttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: