TMEM177-transmembrane protein 177 Gene View larger

TMEM177-transmembrane protein 177 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM177-transmembrane protein 177 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM177-transmembrane protein 177 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004404
Product type: DNA & cDNA
Ncbi symbol: TMEM177
Origin species: Human
Product name: TMEM177-transmembrane protein 177 Gene
Size: 2ug
Accessions: BC004404
Gene id: 80775
Gene description: transmembrane protein 177
Synonyms: transmembrane protein 177
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggtcccctgtggcggaccgcagcatttgtgcagagacacaggacaggcctcttggtgggttcctgtgcaggcctgtttggagttccagtctcgtaccacctcttcccggatcccgtggtccaatggctctaccagtactggcctcagggccagccagctccgctccctccacagctgcagagcctcttccaagaggtgctacaggacataggtgttccttcaggccattgctacaagcccttcaccaccttcaccttccagcctgtgagtgcaggcttcccaagactccctgctggggctgtggtgggcatccctgccagtttcttgggagacctagtgatcaacactaaccatcccgtggtcatacatgggcatacagtggactggcggagcccagcaggcgcccggctgagagcttccctgaccttgtcccgtgaagcccagaagttcgccttggccagggaagtggtgtacctggaaagcagtaccactgccgtgcacgccctgctggccccagcttgcctggcagggacctgggcactgggcgtgggtgccaagtacaccctggggctccatgcaggccccatgaatttacgggctgccttcagcttggtggcagcagtggcaggctttgtggcctacgccttctcccaggattctctcactcatgccgtggagtcctggctggaccgccgcacggcctccctctctgcagcctatgcctgtggtggagtggagttctatgagaagcttctgtcgggcaacctggccctgcgcagtctcttgggcaaagagggggagaagctgtatacacccagcgggaacatcgtccccagacacttgttccgaatcaaacatttaccctacaccacccgccgggactctgtgctgcagatgtggagggggatgctcaatccgggccgctcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GRAM domain containing 1C
- mortality factor 4 like 1
- transmembrane protein 30A
- G protein-coupled receptor 3

Buy TMEM177-transmembrane protein 177 Gene now

Add to cart