TNNT2-troponin T type 2 (cardiac) Gene View larger

TNNT2-troponin T type 2 (cardiac) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNNT2-troponin T type 2 (cardiac) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TNNT2-troponin T type 2 (cardiac) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002653
Product type: DNA & cDNA
Ncbi symbol: TNNT2
Origin species: Human
Product name: TNNT2-troponin T type 2 (cardiac) Gene
Size: 2ug
Accessions: BC002653
Gene id: 7139
Gene description: troponin T type 2 (cardiac)
Synonyms: CMD1D; CMH2; CMPD2; LVNC6; RCM3; TnTC; cTnT; troponin T, cardiac muscle; cardiomyopathy, dilated 1D (autosomal dominant); cardiomyopathy, hypertrophic 2; troponin T type 2 (cardiac); troponin T2, cardiac; truncated cardiac troponin T; troponin T2, cardiac type
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgacatagaagaggtggtggaagagtacgaggaggaggagcaggaagaagcagctgttgaagagcaggaggaggcagcggaagaggatgctgaagcagaggctgagaccgaggagaccagggcagaagaagatgaagaagaagaggaagcaaaggaggctgaagatggcccaatggaggagtccaaaccaaagcccaggtcgttcatgcccaacttggtgcctcccaagatccccgatggagagagagtggactttgatgacatccaccggaagcgcatggagaaggacctgaatgagttgcaggcgctgatcgaggctcactttgagaacaggaagaaagaggaggaggagctcgtttctctcaaagacaggatcgagagacgtcgggcagagcgggccgagcagcagcgcatccggaatgagcgggagaaggagcggcagaaccgcctggctgaagagagggctcgacgagaggaggaggagaacaggaggaaggctgaggatgaggcccggaagaagaaggctttgtccaacatgatgcattttgggggttacatccagaagacagagcggaaaagtgggaagaggcagactgagcgggaaaagaagaagaagattctggctgagaggaggaaggtgctggccattgaccacctgaatgaagatcagctgagggagaaggccaaggagctgtggcagagcatctataacttggaggcagagaagttcgacctgcaggagaagttcaagcagcagaaatatgagatcaatgttctccgaaacaggatcaacgataaccagaaagtctccaagacccgcgggaaggctaaagtcaccgggcgctggaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane channel-like 4
- ketohexokinase (fructokinase)
- thyrotrophic embryonic factor
- HORMA domain containing 2

Buy TNNT2-troponin T type 2 (cardiac) Gene now

Add to cart