Login to display prices
Login to display prices
TNNT2-troponin T type 2 (cardiac) Gene View larger

TNNT2-troponin T type 2 (cardiac) Gene

PTXBC002653

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNNT2-troponin T type 2 (cardiac) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TNNT2-troponin T type 2 (cardiac) Gene

Proteogenix catalog: PTXBC002653
Ncbi symbol: TNNT2
Product name: TNNT2-troponin T type 2 (cardiac) Gene
Size: 2ug
Accessions: BC002653
Gene id: 7139
Gene description: troponin T type 2 (cardiac)
Synonyms: CMD1D; CMH2; CMPD2; LVNC6; RCM3; TnTC; cTnT; troponin T, cardiac muscle; cardiomyopathy, dilated 1D (autosomal dominant); cardiomyopathy, hypertrophic 2; troponin T type 2 (cardiac); troponin T2, cardiac; truncated cardiac troponin T; troponin T2, cardiac type
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgacatagaagaggtggtggaagagtacgaggaggaggagcaggaagaagcagctgttgaagagcaggaggaggcagcggaagaggatgctgaagcagaggctgagaccgaggagaccagggcagaagaagatgaagaagaagaggaagcaaaggaggctgaagatggcccaatggaggagtccaaaccaaagcccaggtcgttcatgcccaacttggtgcctcccaagatccccgatggagagagagtggactttgatgacatccaccggaagcgcatggagaaggacctgaatgagttgcaggcgctgatcgaggctcactttgagaacaggaagaaagaggaggaggagctcgtttctctcaaagacaggatcgagagacgtcgggcagagcgggccgagcagcagcgcatccggaatgagcgggagaaggagcggcagaaccgcctggctgaagagagggctcgacgagaggaggaggagaacaggaggaaggctgaggatgaggcccggaagaagaaggctttgtccaacatgatgcattttgggggttacatccagaagacagagcggaaaagtgggaagaggcagactgagcgggaaaagaagaagaagattctggctgagaggaggaaggtgctggccattgaccacctgaatgaagatcagctgagggagaaggccaaggagctgtggcagagcatctataacttggaggcagagaagttcgacctgcaggagaagttcaagcagcagaaatatgagatcaatgttctccgaaacaggatcaacgataaccagaaagtctccaagacccgcgggaaggctaaagtcaccgggcgctggaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: