C6orf206-chromosome 6 open reading frame 206 Gene View larger

C6orf206-chromosome 6 open reading frame 206 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C6orf206-chromosome 6 open reading frame 206 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C6orf206-chromosome 6 open reading frame 206 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029519
Product type: DNA & cDNA
Ncbi symbol: C6orf206
Origin species: Human
Product name: C6orf206-chromosome 6 open reading frame 206 Gene
Size: 2ug
Accessions: BC029519
Gene id: 221421
Gene description: chromosome 6 open reading frame 206
Synonyms: C6orf206; CILD12; MRPS18AL1; radial spoke head protein 9 homolog; radial spoke head 9 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgccgacagcctcctgctgtctctggagctggcgtccggcagtgggcagggcctcagcccggaccgtcgggcctcgctgctcacgtctcttatgctggttaagcgcgactaccgctatgatcgggttctcttctggggccgcatccttggcctcgtcgccgattactacatcgcgcagggcctgagtgaggaccagctcgcaccgcgcaagacgctctatagcctgaactgcacagagtggagcctcttgccccctgccacagaggagatggtggcgcagtcgtctgtggtgaagggccgcttcatgggggacccatcatacgaatatgaacacactgagctgcagaaggtgaatgaaggtgaaaaagtctttgaagaagaaatagtggtccagatcaaggaagagacccgcttggtgtctgtcattgaccagattgacaaggctgtggccatcatcccccgaggcgccctcttcaagaccccttttggacccacccatgtcaatcggacctttgaaggactgtccttgtctgaggccaagaagctcagctcctacttccatttcagggagcctgttgagctaaagaataagaccttgcttgagaaggctgacctggacccctccctggatttcatggactccttggagcatgacattcccaaagggtcctggagcatccagatggagaggggcaatgccctggtggtgctgcgcagcctgctctggccgggcctcaccttctaccatgctccccgcaccaagaactatggctacgtctacgtgggcactggcgagaagaacatggacttgcccttcatgctatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 10 open reading frame 81
- zinc finger, DHHC-type containing 19
- sulfotransferase family 4A, member 1
- sulfotransferase family 4A, member 1

Buy C6orf206-chromosome 6 open reading frame 206 Gene now

Add to cart