Cart 11 Product Products 1 470,81 € (empty)
-
1 x TRIM38-tri...121,50 € -
1 x KLK8-kalli...113,40 € -
1 x UBR2-ubiqu...121,50 € -
1 x Donkey...269,00 € -
1 x NOP10-NOP1...113,40 € -
-
-
-
1 x CTBS-chito...113,40 € -
1 x MGC33894-t...113,40 € -
1 x NUDCD2-Nud...113,40 €
No products
To be determined Shipping
1 470,81 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 470,81 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 470,81 €
Data sheet of TMEM45B-transmembrane protein 45B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM45B-transmembrane protein 45B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016153 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM45B |
| Origin species: | Human |
| Product name: | TMEM45B-transmembrane protein 45B Gene |
| Size: | 2ug |
| Accessions: | BC016153 |
| Gene id: | 120224 |
| Gene description: | transmembrane protein 45B |
| Synonyms: | transmembrane protein 45B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaatttcaagggccacgcgcttccagggagtttcttcctgatcattgggctgtgttggtcagtgaagtacccgctgaagtactttagccacacgcggaagaacagcccactacattactatcagcgtctcgagatcgtcgaagccgcaattaggactttgttttccgtcactgggatcctggcagagcagtttgttccggatgggccccacctgcacctctaccatgagaaccactggataaagttaatgaattggcagcacagcaccatgtacctattctttgcagtctcaggaattgttgacatgctcacctatctggtcagccacgttcccttgggggtggacagactggttatggctgtggcagtattcatggaaggtttcctcttctactaccacgtccacaaccggcctccgctggaccagcacatccactcactcctgctgtatgctctgttcggagggtgtgttagtatctccctagaggtgatcttccgggaccacattgtgctggaacttttccgaaccagtctcatcattcttcagggaacctggttctggcagattgggtttgtgctgttcccaccttttggaacacccgaatgggaccagaaggatgatgccaacctcatgttcatcaccatgtgcttctgctggcactacctggctgccctcagcattgtggccgtcaactattctcttgtttactgccttttgactcggatgaagagacacggaaggggagaaatcattggaattcagaagctgaattcagatgacacttaccagaccgccctcttgagtggctcagatgaggaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - HCLS1 associated protein X-1 - HCLS1 associated protein X-1 - troponin T type 2 (cardiac) - transmembrane channel-like 4 |