TMEM45B-transmembrane protein 45B Gene View larger

TMEM45B-transmembrane protein 45B Gene

PTXBC016153

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM45B-transmembrane protein 45B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM45B-transmembrane protein 45B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016153
Product type: DNA & cDNA
Ncbi symbol: TMEM45B
Origin species: Human
Product name: TMEM45B-transmembrane protein 45B Gene
Size: 2ug
Accessions: BC016153
Gene id: 120224
Gene description: transmembrane protein 45B
Synonyms: transmembrane protein 45B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaatttcaagggccacgcgcttccagggagtttcttcctgatcattgggctgtgttggtcagtgaagtacccgctgaagtactttagccacacgcggaagaacagcccactacattactatcagcgtctcgagatcgtcgaagccgcaattaggactttgttttccgtcactgggatcctggcagagcagtttgttccggatgggccccacctgcacctctaccatgagaaccactggataaagttaatgaattggcagcacagcaccatgtacctattctttgcagtctcaggaattgttgacatgctcacctatctggtcagccacgttcccttgggggtggacagactggttatggctgtggcagtattcatggaaggtttcctcttctactaccacgtccacaaccggcctccgctggaccagcacatccactcactcctgctgtatgctctgttcggagggtgtgttagtatctccctagaggtgatcttccgggaccacattgtgctggaacttttccgaaccagtctcatcattcttcagggaacctggttctggcagattgggtttgtgctgttcccaccttttggaacacccgaatgggaccagaaggatgatgccaacctcatgttcatcaccatgtgcttctgctggcactacctggctgccctcagcattgtggccgtcaactattctcttgtttactgccttttgactcggatgaagagacacggaaggggagaaatcattggaattcagaagctgaattcagatgacacttaccagaccgccctcttgagtggctcagatgaggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - HCLS1 associated protein X-1
- HCLS1 associated protein X-1
- troponin T type 2 (cardiac)
- transmembrane channel-like 4

Buy TMEM45B-transmembrane protein 45B Gene now

Add to cart