Login to display prices
Login to display prices
TMEM45B-transmembrane protein 45B Gene View larger

TMEM45B-transmembrane protein 45B Gene

PTXBC016153

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM45B-transmembrane protein 45B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM45B-transmembrane protein 45B Gene

Proteogenix catalog: PTXBC016153
Ncbi symbol: TMEM45B
Product name: TMEM45B-transmembrane protein 45B Gene
Size: 2ug
Accessions: BC016153
Gene id: 120224
Gene description: transmembrane protein 45B
Synonyms: transmembrane protein 45B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaatttcaagggccacgcgcttccagggagtttcttcctgatcattgggctgtgttggtcagtgaagtacccgctgaagtactttagccacacgcggaagaacagcccactacattactatcagcgtctcgagatcgtcgaagccgcaattaggactttgttttccgtcactgggatcctggcagagcagtttgttccggatgggccccacctgcacctctaccatgagaaccactggataaagttaatgaattggcagcacagcaccatgtacctattctttgcagtctcaggaattgttgacatgctcacctatctggtcagccacgttcccttgggggtggacagactggttatggctgtggcagtattcatggaaggtttcctcttctactaccacgtccacaaccggcctccgctggaccagcacatccactcactcctgctgtatgctctgttcggagggtgtgttagtatctccctagaggtgatcttccgggaccacattgtgctggaacttttccgaaccagtctcatcattcttcagggaacctggttctggcagattgggtttgtgctgttcccaccttttggaacacccgaatgggaccagaaggatgatgccaacctcatgttcatcaccatgtgcttctgctggcactacctggctgccctcagcattgtggccgtcaactattctcttgtttactgccttttgactcggatgaagagacacggaaggggagaaatcattggaattcagaagctgaattcagatgacacttaccagaccgccctcttgagtggctcagatgaggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: