BAG1-BCL2-associated athanogene Gene View larger

BAG1-BCL2-associated athanogene Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BAG1-BCL2-associated athanogene Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BAG1-BCL2-associated athanogene Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001936
Product type: DNA & cDNA
Ncbi symbol: BAG1
Origin species: Human
Product name: BAG1-BCL2-associated athanogene Gene
Size: 2ug
Accessions: BC001936
Gene id: 573
Gene description: BCL2-associated athanogene
Synonyms: HAP; RAP46; BAG family molecular chaperone regulator 1; BCL2-associated athanogene; Bcl-2 associating athanogene-1 protein; Bcl-2-binding protein; glucocortoid receptor-associated protein RAP46; receptor-associated protein, 46-KD; BCL2 associated athanogene 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagaagaaaacccggcgccgctcgacccggagcgaggagttgacccggagcgaggagttgaccctgagtgaggaagcgacctggagtgaagaggcgacccagagtgaggaggcgacccagggcgaagagatgaatcggagccaggaggtgacccgggacgaggagtcgacccggagcgaggaggtgaccagggaggaaatggcggcagctgggctcaccgtgactgtcacccacagcaatgagaagcacgaccttcatgttacctcccagcagggcagcagtgaaccagttgtccaagacctggcccaggttgttgaagaggtcataggggttccacagtcttttcagaaactcatatttaagggaaaatctctgaaggaaatggaaacaccgttgtcagcacttggaatacaagatggttgccgggtcatgttaattgggaaaaagaacagtccacaggaagaggttgaactaaagaagttgaaacatttggagaagtctgtggagaagatagctgaccagctggaagagttgaataaagagcttactggaatccagcagggttttctgcccaaggatttgcaagctgaagctctctgcaaacttgataggagagtaaaagccacaatagagcagtttatgaagatcttggaggagattgacacactgatcctgccagaaaatttcaaagacagtagattgaaaaggaaaggcttggtaaaaaaggttcaggcattcctagccgagtgtgacacagtggagcagaacatctgccaggagactgagcggctgcagtctacaaactttgccctggccgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - poly(A) polymerase alpha
- ret finger protein-like 3
- sushi domain containing 4
- RWD domain containing 2A

Buy BAG1-BCL2-associated athanogene Gene now

Add to cart