PCGF1-polycomb group ring finger 1 Gene View larger

PCGF1-polycomb group ring finger 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCGF1-polycomb group ring finger 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PCGF1-polycomb group ring finger 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004952
Product type: DNA & cDNA
Ncbi symbol: PCGF1
Origin species: Human
Product name: PCGF1-polycomb group ring finger 1 Gene
Size: 2ug
Accessions: BC004952
Gene id: 84759
Gene description: polycomb group ring finger 1
Synonyms: 2010002K04Rik; NSPC1; RNF3A-2; RNF68; polycomb group RING finger protein 1; RING finger protein 68; nervous system Polycomb-1; polycomb group ring finger 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggcttcggaaccagctccagtcagtgtacaagatggacccgctacggaacgaggaggaggttcgagtgaagatcaaagacttgaatgaacacattgtttgctgcctatgcgccggctacttcgtggatgccaccaccatcacagagtgtcttcatactttctgcaagagttgtattgtgaagtacctccaaactagcaagtactgccccatgtgcaacattaagatccacgagacacagccactgctcaacctcaaactggaccgggtcatgcaggacatcgtgtataagctggtgcctggcttgcaagacagtgaagagaaacggattcgggaattctaccagtcccgaggtttggaccgggtcacccagcccactggggaagagccagcactgagcaacctcggcctccccttcagcagctttgaccactctaaagcccactactatcgctatgatgagcagttgaacctgtgcctggagcggctgagttctggcaaagacaagaataaaagcgtcctgcagaacaagtatgtccgatgttctgttagagctgaggtacgccatctccggagggtcctgtgtcaccgcttgatgctaaaccctcagcatgtgcagctcctttttgacaatgaagttctccctgatcacatgacaatgaagcagatatggctctcccgctggttcggcaagccatcccctttgcttttacaatacagtgtgaaagagaagaggaggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - integral membrane protein 2B
- snail homolog 2 (Drosophila)
- phospholipase A2, group XV
- four and a half LIM domains 1

Buy PCGF1-polycomb group ring finger 1 Gene now

Add to cart