Login to display prices
Login to display prices
APTX-aprataxin Gene View larger

APTX-aprataxin Gene

PTXBC001628

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APTX-aprataxin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about APTX-aprataxin Gene

Proteogenix catalog: PTXBC001628
Ncbi symbol: APTX
Product name: APTX-aprataxin Gene
Size: 2ug
Accessions: BC001628
Gene id: 54840
Gene description: aprataxin
Synonyms: AOA; AOA1; AXA1; EAOH; EOAHA; FHA-HIT; aprataxin; forkhead-associated domain histidine triad-like protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggaccccaaaatgcaggtttacaaagatgagcaggtggtggtgataaaggataaatacccaaaggcccgttaccattggctggtcttaccgtggacctccatttccagtctgaaggctgtggccagggaacaccttgaactccttaagcatatgcacactgtgggggaaaaggtgattgtagattttgctgggtccagcaaactccgcttccgattgggctaccacgccattccgagtatgagccatgtacatcttcatgtgatcagccaggattttgattctccttgccttaaaaacaaaaaacattggaattctttcaatacagaatacttcctagaatcacaagctgtgatcgagatggtacaagaggctggtagagtaactgtccgagatgggatgcctgagctcttgaagctgccccttcgttgtcatgagtgccagcagctgctgccttccattcctcagctgaaagaacatctcaggaagcactggacacagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice