KRT8-keratin 8 Gene View larger

KRT8-keratin 8 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KRT8-keratin 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KRT8-keratin 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008200
Product type: DNA & cDNA
Ncbi symbol: KRT8
Origin species: Human
Product name: KRT8-keratin 8 Gene
Size: 2ug
Accessions: BC008200
Gene id: 3856
Gene description: keratin 8
Synonyms: CARD2; CK-8; CK8; CYK8; K2C8; keratin, type II cytoskeletal 8; cytokeratin-8; keratin 8, type II; type-II keratin Kb8; keratin 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaaggtagagctggagtctcgcctggaagggctgaccgacgagatcaacttcctcaggcagctatatgaagaggagatccgggagctgcagtcccagatctcggacacatctgtggtgctgtccatggacaacagccgctccctggacatggacagcatcattgctgaggtcaaggcacagtacgaggatattgccaaccgcagccgggctgaggctgagagcatgtaccagatcaagtatgaggagctgcagagcctggctgggaagcacggggatgacctgcggcgcacaaagactgagatctctgagatgaaccggaacatcagccggctccaggctgagattgagggcctcaaaggccagagggcttccctggaggccgccattgcagatgccgagcagcgtggagagctggccattaaggatgccaacgccaagttgtccgagctggaggccgccctgcagcgggccaagcaggacatggcgcggcagctgcgtgagtaccaggagctgatgaacgtcaagctggccctggacatcgagatcgccacctacaggaagctgctggagggcgaggagagccggctggagtctgggatgcagaacatgagtattcatacgaagaccaccagcggctatgcaggtggtctgagctcggcctatgggggcctcacaagccccggcctcagctacagcctgggctccagctttggctctggcgcgggctccagctccttcagccgcaccagctcctccagggccgtggttgtgaagaagatcgagacacgtgatgggaagctggtgtctgagtcctctgacgtcctgcccaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calumenin
- JTV1 gene
- keratocan
- tsukushin

Buy KRT8-keratin 8 Gene now

Add to cart