Login to display prices
Login to display prices
TSKU-tsukushin Gene View larger

TSKU-tsukushin Gene

PTXBC020975

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSKU-tsukushin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TSKU-tsukushin Gene

Proteogenix catalog: PTXBC020975
Ncbi symbol: TSKU
Product name: TSKU-tsukushin Gene
Size: 2ug
Accessions: BC020975
Gene id: 25987
Gene description: tsukushin
Synonyms: E2IG4; LRRC54; TSK; tsukushin; E2-induced gene 4 protein; leucine rich repeat containing 54; leucine-rich repeat-containing protein 54; tsukushi homolog; tsukushi small leucine rich proteoglycan homolog; tsukushi, small leucine rich proteoglycan
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgtggcccctgctgctgctgctggccgtgagtggggcccagacaacccggccatgcttccccgggtgccaatgcgaggtggagaccttcggccttttcgacagcttcagcctgactcgggtggattgtagcggcctgggcccccacatcatgccggtgcccatccctctggacacagcccacttggacctgtcctccaaccggctggagatggtgaatgagtcggtgttggcggggccgggctacacgacgttggctggcctggatctcagccacaacctgctcaccagcatctcacccactgccttctcccgccttcgctacctggagtcgcttgacctcagccacaatggcctgacagccctgccagccgagagcttcaccagctcacccctgagcgacgtgaaccttagccacaaccagctccgggaggtctcagtgtctgccttcacgacgcacagtcagggccgggcactacacgtggacctctcccacaacctcattcaccgcctcgtgccccaccccacgagggccggcctgcctgcgcccaccattcagagcctgaacctggcctggaaccggctccatgccgtgcccaacctccgagacttgcccctgcgctacctgagcctggatgggaaccctctagctgtcattggtccgggtgccttcgcggggctgggaggccttacacacctgtctctggccagcctgcagaggctccctgagctggcgcccagtggcttccgtgagctaccgggcctgcaggtcctggacctgtcgggcaaccccaagcttaactgggcaggagctgaggtgttttcaggcctgagctccctgcaggagctggacctttcgggcaccaacctggtgcccctgcctgaggcgctgctcctccacctcccggcactgcagagcgtcagcgtgggccaggatgtgcggtgccggcgcctggtgcgggagggcacctacccccggaggcctggctccagccccaaggtggccctgcactgcgtagacacccgggattctgctgccaggggccccaccatcttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: