Cart 20 Product Products 3 817,09 € (empty)
-
1 x DEFB1-defe...113,40 € -
-
1 x Goat...199,00 € -
1 x PPAP2B-pho...121,50 € -
1 x HSDL1-hydr...121,50 € -
1 x ACTR2-ARP2...121,50 € -
1 x PRPF40A-PR...113,40 € -
1 x GMPR2-guan...121,50 € -
1 x Chicken...311,00 € -
1 x DNAJA4-Dna...121,50 € -
1 x CKS2-CDC28...113,40 € -
1 x Goat...1 189,00 € -
1 x Goat...201,00 € -
-
1 x DLK1-delta...121,50 € -
1 x DVL1-dishe...121,50 € -
1 x AVL9-AVL9...121,50 € -
1 x POLB-polym...121,50 € -
-
1 x BUB3-buddi...121,50 €
No products
To be determined Shipping
3 817,09 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 20 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 817,09 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 817,09 €
Data sheet of 39693-septin 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about 39693-septin 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033559 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | 39693 |
| Origin species: | Human |
| Product name: | 39693-septin 2 Gene |
| Size: | 2ug |
| Accessions: | BC033559 |
| Gene id: | 4735 |
| Gene description: | septin 2 |
| Synonyms: | septin 2; DIFF6; NEDD-5; NEDD5; Pnutl3; hNedd5; septin-2; neural precursor cell expressed developmentally down-regulated protein 5; neural precursor cell expressed, developmentally down-regulated 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctaagcaacagccaactcagtttataaatccagaaacacctggctatgttggatttgcaaacctccccaatcaagttcaccgaaaatcagtgaaaaaaggttttgagttcacactgatggtggtcggtgaatcaggtctaggaaaatcgactctcataaacagcctattcctaactgatctgtacccagaaagagtcatacctggagcagcagctttgaacacaaggaaaacacttttatgggaaaaaattgaaagaactgtccagattgaggcttcaactgttgaaattgaagagcgaggggtcaagctacgcctgacagtggtagatacccctggctatggtgacgctatcaactgcagagattgttttaagacaattatctcctatattgatgagcaatttgagaggtacctgcatgacgagagcggcttgaacaggcggcacatcattgataatagggtgcattgttgcttttactttatttcaccttttggacatggacttaagcccttagatgtggcgtttatgaaggcaatacacaacaaggtgaatattgtgcctgtcattgcaaaagctgacactctcaccctgaaggaacgggagcggctgaagaaaaggattctggatgaaattgaagaacataacatcaaaatctatcacttacctgatgcagaatcagatgaagatgaagattttaaagagcagactagacttctcaaggctagcatcccattctctgtggttggatccaatcagttgattgaagccaaaggaaagaaggtcagaggccgcctctacccctggggtgttgtggaagtggagaacccagagcacaatgactttctgaagctgagaaccatgctcatcacccacatgcaggatctccaggaggtgacccaggaccttcattatgaaaacttccgttctgagagactcaagagaggcggcaggaaagtggagaatgaggacatgaataaagaccagatcttgctggaaaaagaagctgagctccgccgcatgcaagagatgattgcaaggatgcaggcgcagatgcagatgcagatgcagggcggggatggcgatggcggggctctcgggcaccacgtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - keratin 7 - T-box 22 - myoneurin - midline 2 |