Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HMGA1-high mobility group AT-hook 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HMGA1-high mobility group AT-hook 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008832 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HMGA1 |
| Origin species: | Human |
| Product name: | HMGA1-high mobility group AT-hook 1 Gene |
| Size: | 2ug |
| Accessions: | BC008832 |
| Gene id: | 3159 |
| Gene description: | high mobility group AT-hook 1 |
| Synonyms: | HMG-R; HMGA1A; HMGIY; high mobility group protein HMG-I/HMG-Y; high mobility group protein A1; high mobility group protein R; high-mobility group (nonhistone chromosomal) protein isoforms I and Y; nonhistone chromosomal high-mobility group protein HMG-I/HMG-Y; high mobility group AT-hook 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgagtcgagctcgaagtccagccagcccttggcctccaagcaggaaaaggacggcactgagaagcggggccggggcaggccgcgcaagcagcctccggtgagtcccgggacagcgctggtagggagtcagaaggagcccagcgaagtgccaacacctaagagacctcggggccgaccaaagggaagcaaaaacaagggtgctgccaagacccggaaaaccaccacaactccaggaaggaaaccaaggggcagacccaaaaaactggagaaggaggaagaggagggcatctcgcaggagtcctcggaggaggagcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nephronophthisis 1 (juvenile) - serum amyloid A4, constitutive - FK506 binding protein 9-like - Tctex1 domain containing 2 |