Login to display prices
Login to display prices
HMGA1-high mobility group AT-hook 1 Gene View larger

HMGA1-high mobility group AT-hook 1 Gene

PTXBC008832

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HMGA1-high mobility group AT-hook 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HMGA1-high mobility group AT-hook 1 Gene

Proteogenix catalog: PTXBC008832
Ncbi symbol: HMGA1
Product name: HMGA1-high mobility group AT-hook 1 Gene
Size: 2ug
Accessions: BC008832
Gene id: 3159
Gene description: high mobility group AT-hook 1
Synonyms: HMG-R; HMGA1A; HMGIY; high mobility group protein HMG-I/HMG-Y; high mobility group protein A1; high mobility group protein R; high-mobility group (nonhistone chromosomal) protein isoforms I and Y; nonhistone chromosomal high-mobility group protein HMG-I/HMG-Y; high mobility group AT-hook 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgagtcgagctcgaagtccagccagcccttggcctccaagcaggaaaaggacggcactgagaagcggggccggggcaggccgcgcaagcagcctccggtgagtcccgggacagcgctggtagggagtcagaaggagcccagcgaagtgccaacacctaagagacctcggggccgaccaaagggaagcaaaaacaagggtgctgccaagacccggaaaaccaccacaactccaggaaggaaaccaaggggcagacccaaaaaactggagaaggaggaagaggagggcatctcgcaggagtcctcggaggaggagcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: