NPHP1-nephronophthisis 1 (juvenile) Gene View larger

NPHP1-nephronophthisis 1 (juvenile) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NPHP1-nephronophthisis 1 (juvenile) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NPHP1-nephronophthisis 1 (juvenile) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009789
Product type: DNA & cDNA
Ncbi symbol: NPHP1
Origin species: Human
Product name: NPHP1-nephronophthisis 1 (juvenile) Gene
Size: 2ug
Accessions: BC009789
Gene id: 4867
Gene description: nephronophthisis 1 (juvenile)
Synonyms: JBTS4; NPH1; SLSN1; nephrocystin-1; juvenile nephronophthisis 1 protein; nephronophthisis 1 (juvenile); nephrocystin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggcgagacgacagcgagatcctctccaggccctgcggcgccgcaatcaggagctgaagcaacaggttgatagtttgctttctgagagccaactgaaagaagctctagaacccaataaaagacaacatatttatcaaagatgtatccagttaaagcaggcaatagatgaaaataaaaatgctcttcaaaaattaagcaaagctgatgaatctgcacctgttgcaaactataatcagagaaaagaagaggagcatactcttttggacaagcttacccaacaactgcagggccttgctgtgacaataagcagagaaaatataactgagtatgcttcctttctacctttcttttttcttttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serum amyloid A4, constitutive
- FK506 binding protein 9-like
- Tctex1 domain containing 2
- phospholipase A2, group IID

Buy NPHP1-nephronophthisis 1 (juvenile) Gene now

Add to cart