Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GLRX-glutaredoxin (thioltransferase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GLRX-glutaredoxin (thioltransferase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005304 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GLRX |
| Origin species: | Human |
| Product name: | GLRX-glutaredoxin (thioltransferase) Gene |
| Size: | 2ug |
| Accessions: | BC005304 |
| Gene id: | 2745 |
| Gene description: | glutaredoxin (thioltransferase) |
| Synonyms: | GRX; GRX1; glutaredoxin-1; TTase-1; thioltransferase; thioltransferase-1; glutaredoxin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcaagagtttgtgaactgcaaaatccagcctgggaaggtggttgtgttcatcaagcccacctgcccgtactgcaggagggcccaagagatcctcagtcaattgcccatcaaacaagggcttctggaatttgtcgatatcacagccaccaaccacactaacgagattcaagattatttgcaacagctcacgggagcaagaacggtgcctcgagtctttattggtaaagattgtataggcggatgcagtgatctagtctctttgcaacagagtggggaactgctgacgcggctaaagcagattggagctctgcagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphohistidine phosphatase 1 - jumping translocation breakpoint - glycophorin A (MNS blood group) - glycophorin A (MNS blood group) |