GLRX-glutaredoxin (thioltransferase) Gene View larger

GLRX-glutaredoxin (thioltransferase) Gene

PTXBC005304

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GLRX-glutaredoxin (thioltransferase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GLRX-glutaredoxin (thioltransferase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005304
Product type: DNA & cDNA
Ncbi symbol: GLRX
Origin species: Human
Product name: GLRX-glutaredoxin (thioltransferase) Gene
Size: 2ug
Accessions: BC005304
Gene id: 2745
Gene description: glutaredoxin (thioltransferase)
Synonyms: GRX; GRX1; glutaredoxin-1; TTase-1; thioltransferase; thioltransferase-1; glutaredoxin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcaagagtttgtgaactgcaaaatccagcctgggaaggtggttgtgttcatcaagcccacctgcccgtactgcaggagggcccaagagatcctcagtcaattgcccatcaaacaagggcttctggaatttgtcgatatcacagccaccaaccacactaacgagattcaagattatttgcaacagctcacgggagcaagaacggtgcctcgagtctttattggtaaagattgtataggcggatgcagtgatctagtctctttgcaacagagtggggaactgctgacgcggctaaagcagattggagctctgcagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphohistidine phosphatase 1
- jumping translocation breakpoint
- glycophorin A (MNS blood group)
- glycophorin A (MNS blood group)

Buy GLRX-glutaredoxin (thioltransferase) Gene now

Add to cart