MGC21881-hypothetical locus MGC21881 Gene View larger

MGC21881-hypothetical locus MGC21881 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC21881-hypothetical locus MGC21881 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MGC21881-hypothetical locus MGC21881 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027338
Product type: DNA & cDNA
Ncbi symbol: MGC21881
Origin species: Human
Product name: MGC21881-hypothetical locus MGC21881 Gene
Size: 2ug
Accessions: BC027338
Gene id: 389741
Gene description: hypothetical locus MGC21881
Synonyms: uncharacterized locus MGC21881
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagaaagctgagactcagggccagcaacccgggtcccagcggagcgcccggcacacgccgacacttcagcaccagtggcggtggccaccactgtgcgcggagatggctgcgacgcgtgcgcagatctcgatcccaaactccctcctgccagaatctggacccgaatccacccattgcccgttttctgctgccgctggagagaatctctgaggtccccaggagagcctgcctgcacggaagagacgcctcctcggtatggccgcccccggagaggagcgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutaredoxin (thioltransferase)
- phosphohistidine phosphatase 1
- jumping translocation breakpoint
- glycophorin A (MNS blood group)

Buy MGC21881-hypothetical locus MGC21881 Gene now

Add to cart