Login to display prices
Login to display prices
ERC1-ELKS/RAB6-interacting/CAST family member 1 Gene View larger

ERC1-ELKS/RAB6-interacting/CAST family member 1 Gene

PTXBC005065

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ERC1-ELKS/RAB6-interacting/CAST family member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ERC1-ELKS/RAB6-interacting/CAST family member 1 Gene

Proteogenix catalog: PTXBC005065
Ncbi symbol: ERC1
Product name: ERC1-ELKS/RAB6-interacting/CAST family member 1 Gene
Size: 2ug
Accessions: BC005065
Gene id: 23085
Gene description: ELKS/RAB6-interacting/CAST family member 1
Synonyms: Cast2; ELKS; ERC-1; RAB6IP2; ELKS/Rab6-interacting/CAST family member 1; RAB6 interacting protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctaaacaagtggtctggcacgggcactggccagctgctctctccaagcaggtggcccagatcccacccacgtggactttctcatcaggtgcagcgcctgccactctcagccactgggtgtgtgactctcctcttcatctcagcattctccatcacttcccctccagaaaaacggatggaaggaagccctctgtgacactgcttctgagaagaagcatttccgggaccgatatcatctgtctggtctctgtgaacagcaaggaatcttcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: